ID: 1081677147

View in Genome Browser
Species Human (GRCh38)
Location 11:44976878-44976900
Sequence GAGCAGGAATTTTGGTTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081677147_1081677151 -3 Left 1081677147 11:44976878-44976900 CCTAGCAACCAAAATTCCTGCTC No data
Right 1081677151 11:44976898-44976920 CTCCAGCTGAGAAGGAAGCATGG No data
1081677147_1081677153 1 Left 1081677147 11:44976878-44976900 CCTAGCAACCAAAATTCCTGCTC No data
Right 1081677153 11:44976902-44976924 AGCTGAGAAGGAAGCATGGCCGG No data
1081677147_1081677157 29 Left 1081677147 11:44976878-44976900 CCTAGCAACCAAAATTCCTGCTC No data
Right 1081677157 11:44976930-44976952 GCTGCCACAGAGCTAGGCTCTGG No data
1081677147_1081677158 30 Left 1081677147 11:44976878-44976900 CCTAGCAACCAAAATTCCTGCTC No data
Right 1081677158 11:44976931-44976953 CTGCCACAGAGCTAGGCTCTGGG No data
1081677147_1081677156 23 Left 1081677147 11:44976878-44976900 CCTAGCAACCAAAATTCCTGCTC No data
Right 1081677156 11:44976924-44976946 GGCTGAGCTGCCACAGAGCTAGG No data
1081677147_1081677154 2 Left 1081677147 11:44976878-44976900 CCTAGCAACCAAAATTCCTGCTC No data
Right 1081677154 11:44976903-44976925 GCTGAGAAGGAAGCATGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081677147 Original CRISPR GAGCAGGAATTTTGGTTGCT AGG (reversed) Intergenic