ID: 1081677150

View in Genome Browser
Species Human (GRCh38)
Location 11:44976894-44976916
Sequence GCTTCCTTCTCAGCTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081677150_1081677157 13 Left 1081677150 11:44976894-44976916 CCTGCTCCAGCTGAGAAGGAAGC No data
Right 1081677157 11:44976930-44976952 GCTGCCACAGAGCTAGGCTCTGG No data
1081677150_1081677158 14 Left 1081677150 11:44976894-44976916 CCTGCTCCAGCTGAGAAGGAAGC No data
Right 1081677158 11:44976931-44976953 CTGCCACAGAGCTAGGCTCTGGG No data
1081677150_1081677156 7 Left 1081677150 11:44976894-44976916 CCTGCTCCAGCTGAGAAGGAAGC No data
Right 1081677156 11:44976924-44976946 GGCTGAGCTGCCACAGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081677150 Original CRISPR GCTTCCTTCTCAGCTGGAGC AGG (reversed) Intergenic