ID: 1081677152

View in Genome Browser
Species Human (GRCh38)
Location 11:44976900-44976922
Sequence GGCCATGCTTCCTTCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081677152_1081677158 8 Left 1081677152 11:44976900-44976922 CCAGCTGAGAAGGAAGCATGGCC No data
Right 1081677158 11:44976931-44976953 CTGCCACAGAGCTAGGCTCTGGG No data
1081677152_1081677157 7 Left 1081677152 11:44976900-44976922 CCAGCTGAGAAGGAAGCATGGCC No data
Right 1081677157 11:44976930-44976952 GCTGCCACAGAGCTAGGCTCTGG No data
1081677152_1081677156 1 Left 1081677152 11:44976900-44976922 CCAGCTGAGAAGGAAGCATGGCC No data
Right 1081677156 11:44976924-44976946 GGCTGAGCTGCCACAGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081677152 Original CRISPR GGCCATGCTTCCTTCTCAGC TGG (reversed) Intergenic