ID: 1081677156

View in Genome Browser
Species Human (GRCh38)
Location 11:44976924-44976946
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081677150_1081677156 7 Left 1081677150 11:44976894-44976916 CCTGCTCCAGCTGAGAAGGAAGC No data
Right 1081677156 11:44976924-44976946 GGCTGAGCTGCCACAGAGCTAGG No data
1081677147_1081677156 23 Left 1081677147 11:44976878-44976900 CCTAGCAACCAAAATTCCTGCTC No data
Right 1081677156 11:44976924-44976946 GGCTGAGCTGCCACAGAGCTAGG No data
1081677148_1081677156 15 Left 1081677148 11:44976886-44976908 CCAAAATTCCTGCTCCAGCTGAG No data
Right 1081677156 11:44976924-44976946 GGCTGAGCTGCCACAGAGCTAGG No data
1081677152_1081677156 1 Left 1081677152 11:44976900-44976922 CCAGCTGAGAAGGAAGCATGGCC No data
Right 1081677156 11:44976924-44976946 GGCTGAGCTGCCACAGAGCTAGG No data
1081677146_1081677156 30 Left 1081677146 11:44976871-44976893 CCAGGATCCTAGCAACCAAAATT No data
Right 1081677156 11:44976924-44976946 GGCTGAGCTGCCACAGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081677156 Original CRISPR GGCTGAGCTGCCACAGAGCT AGG Intergenic