ID: 1081677158

View in Genome Browser
Species Human (GRCh38)
Location 11:44976931-44976953
Sequence CTGCCACAGAGCTAGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081677150_1081677158 14 Left 1081677150 11:44976894-44976916 CCTGCTCCAGCTGAGAAGGAAGC No data
Right 1081677158 11:44976931-44976953 CTGCCACAGAGCTAGGCTCTGGG No data
1081677147_1081677158 30 Left 1081677147 11:44976878-44976900 CCTAGCAACCAAAATTCCTGCTC No data
Right 1081677158 11:44976931-44976953 CTGCCACAGAGCTAGGCTCTGGG No data
1081677152_1081677158 8 Left 1081677152 11:44976900-44976922 CCAGCTGAGAAGGAAGCATGGCC No data
Right 1081677158 11:44976931-44976953 CTGCCACAGAGCTAGGCTCTGGG No data
1081677148_1081677158 22 Left 1081677148 11:44976886-44976908 CCAAAATTCCTGCTCCAGCTGAG No data
Right 1081677158 11:44976931-44976953 CTGCCACAGAGCTAGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081677158 Original CRISPR CTGCCACAGAGCTAGGCTCT GGG Intergenic