ID: 1081678106

View in Genome Browser
Species Human (GRCh38)
Location 11:44982793-44982815
Sequence CATGGTCCACAGATGCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081678106_1081678117 27 Left 1081678106 11:44982793-44982815 CCCAGTTGCATCTGTGGACCATG No data
Right 1081678117 11:44982843-44982865 CTGCAGCCAATGGAAGGCCCCGG No data
1081678106_1081678110 -6 Left 1081678106 11:44982793-44982815 CCCAGTTGCATCTGTGGACCATG No data
Right 1081678110 11:44982810-44982832 ACCATGGGCTCTCTGCCTTCTGG No data
1081678106_1081678115 17 Left 1081678106 11:44982793-44982815 CCCAGTTGCATCTGTGGACCATG No data
Right 1081678115 11:44982833-44982855 CCTCTGATGGCTGCAGCCAATGG No data
1081678106_1081678112 4 Left 1081678106 11:44982793-44982815 CCCAGTTGCATCTGTGGACCATG No data
Right 1081678112 11:44982820-44982842 CTCTGCCTTCTGGCCTCTGATGG No data
1081678106_1081678116 21 Left 1081678106 11:44982793-44982815 CCCAGTTGCATCTGTGGACCATG No data
Right 1081678116 11:44982837-44982859 TGATGGCTGCAGCCAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081678106 Original CRISPR CATGGTCCACAGATGCAACT GGG (reversed) Intergenic
No off target data available for this crispr