ID: 1081678390

View in Genome Browser
Species Human (GRCh38)
Location 11:44984695-44984717
Sequence CAGGCTAGTCTGGAACTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081678385_1081678390 30 Left 1081678385 11:44984642-44984664 CCTAGCTAATTTTTGAAAAGTTA 0: 2
1: 1
2: 102
3: 2696
4: 73723
Right 1081678390 11:44984695-44984717 CAGGCTAGTCTGGAACTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081678390 Original CRISPR CAGGCTAGTCTGGAACTTGC GGG Intergenic
No off target data available for this crispr