ID: 1081679396

View in Genome Browser
Species Human (GRCh38)
Location 11:44991018-44991040
Sequence ACTTAATCTCCCTATGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081679396_1081679402 24 Left 1081679396 11:44991018-44991040 CCCACACCATAGGGAGATTAAGT No data
Right 1081679402 11:44991065-44991087 ACGCAGAAGGTGCCAAGTCAGGG No data
1081679396_1081679404 28 Left 1081679396 11:44991018-44991040 CCCACACCATAGGGAGATTAAGT No data
Right 1081679404 11:44991069-44991091 AGAAGGTGCCAAGTCAGGGAGGG No data
1081679396_1081679400 11 Left 1081679396 11:44991018-44991040 CCCACACCATAGGGAGATTAAGT No data
Right 1081679400 11:44991052-44991074 AATTGATAAAACAACGCAGAAGG No data
1081679396_1081679401 23 Left 1081679396 11:44991018-44991040 CCCACACCATAGGGAGATTAAGT No data
Right 1081679401 11:44991064-44991086 AACGCAGAAGGTGCCAAGTCAGG No data
1081679396_1081679403 27 Left 1081679396 11:44991018-44991040 CCCACACCATAGGGAGATTAAGT No data
Right 1081679403 11:44991068-44991090 CAGAAGGTGCCAAGTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081679396 Original CRISPR ACTTAATCTCCCTATGGTGT GGG (reversed) Intergenic
No off target data available for this crispr