ID: 1081679777

View in Genome Browser
Species Human (GRCh38)
Location 11:44994160-44994182
Sequence CCACCTGGAAGGTGAGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081679777_1081679784 -4 Left 1081679777 11:44994160-44994182 CCCTCAGCTCACCTTCCAGGTGG No data
Right 1081679784 11:44994179-44994201 GTGGTTCTGTGGGTTCACTGTGG No data
1081679777_1081679785 15 Left 1081679777 11:44994160-44994182 CCCTCAGCTCACCTTCCAGGTGG No data
Right 1081679785 11:44994198-44994220 GTGGTTGTTCTTTCTGATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081679777 Original CRISPR CCACCTGGAAGGTGAGCTGA GGG (reversed) Intergenic
No off target data available for this crispr