ID: 1081680319

View in Genome Browser
Species Human (GRCh38)
Location 11:44998021-44998043
Sequence CTCCCAAAGGGCAGATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081680319_1081680327 18 Left 1081680319 11:44998021-44998043 CCTTCCAATCTGCCCTTTGGGAG No data
Right 1081680327 11:44998062-44998084 GACTTACTGTGTGCTAGTGCTGG No data
1081680319_1081680328 19 Left 1081680319 11:44998021-44998043 CCTTCCAATCTGCCCTTTGGGAG No data
Right 1081680328 11:44998063-44998085 ACTTACTGTGTGCTAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081680319 Original CRISPR CTCCCAAAGGGCAGATTGGA AGG (reversed) Intergenic
No off target data available for this crispr