ID: 1081684527

View in Genome Browser
Species Human (GRCh38)
Location 11:45032898-45032920
Sequence TAGTTGATCTGGAAGGATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081684527_1081684531 -5 Left 1081684527 11:45032898-45032920 CCCTTATCCTTCCAGATCAACTA No data
Right 1081684531 11:45032916-45032938 AACTAAATGCCCCCTCCTCCAGG No data
1081684527_1081684532 -2 Left 1081684527 11:45032898-45032920 CCCTTATCCTTCCAGATCAACTA No data
Right 1081684532 11:45032919-45032941 TAAATGCCCCCTCCTCCAGGAGG 0: 2
1: 0
2: 11
3: 46
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081684527 Original CRISPR TAGTTGATCTGGAAGGATAA GGG (reversed) Intergenic
No off target data available for this crispr