ID: 1081686664

View in Genome Browser
Species Human (GRCh38)
Location 11:45047799-45047821
Sequence AAGGGTAAAGTTCTGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081686664_1081686669 -5 Left 1081686664 11:45047799-45047821 CCTGCCTCCAGAACTTTACCCTT No data
Right 1081686669 11:45047817-45047839 CCCTTGTCATGCCTCTGGCCTGG No data
1081686664_1081686667 -10 Left 1081686664 11:45047799-45047821 CCTGCCTCCAGAACTTTACCCTT No data
Right 1081686667 11:45047812-45047834 CTTTACCCTTGTCATGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081686664 Original CRISPR AAGGGTAAAGTTCTGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr