ID: 1081688096

View in Genome Browser
Species Human (GRCh38)
Location 11:45056605-45056627
Sequence GAGGATGGGGAGCCAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081688096_1081688105 19 Left 1081688096 11:45056605-45056627 CCTCCTCCTGGCTCCCCATCCTC No data
Right 1081688105 11:45056647-45056669 TTCCACATTCCTGCTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081688096 Original CRISPR GAGGATGGGGAGCCAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr