ID: 1081691316

View in Genome Browser
Species Human (GRCh38)
Location 11:45080439-45080461
Sequence CTGTAGGCAGGGGGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081691316_1081691325 7 Left 1081691316 11:45080439-45080461 CCATCCTCACCCCCTGCCTACAG No data
Right 1081691325 11:45080469-45080491 AACTCCTGCCAAGCCCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081691316 Original CRISPR CTGTAGGCAGGGGGTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr