ID: 1081691316 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:45080439-45080461 |
Sequence | CTGTAGGCAGGGGGTGAGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1081691316_1081691325 | 7 | Left | 1081691316 | 11:45080439-45080461 | CCATCCTCACCCCCTGCCTACAG | No data | ||
Right | 1081691325 | 11:45080469-45080491 | AACTCCTGCCAAGCCCTAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1081691316 | Original CRISPR | CTGTAGGCAGGGGGTGAGGA TGG (reversed) | Intergenic | ||
No off target data available for this crispr |