ID: 1081693414

View in Genome Browser
Species Human (GRCh38)
Location 11:45093647-45093669
Sequence CTCCCACACCGCCGCTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081693414_1081693418 9 Left 1081693414 11:45093647-45093669 CCACAGAAGCGGCGGTGTGGGAG No data
Right 1081693418 11:45093679-45093701 GCTCTAGCTGTTCCATGTGTGGG No data
1081693414_1081693419 10 Left 1081693414 11:45093647-45093669 CCACAGAAGCGGCGGTGTGGGAG No data
Right 1081693419 11:45093680-45093702 CTCTAGCTGTTCCATGTGTGGGG No data
1081693414_1081693417 8 Left 1081693414 11:45093647-45093669 CCACAGAAGCGGCGGTGTGGGAG No data
Right 1081693417 11:45093678-45093700 TGCTCTAGCTGTTCCATGTGTGG No data
1081693414_1081693421 30 Left 1081693414 11:45093647-45093669 CCACAGAAGCGGCGGTGTGGGAG No data
Right 1081693421 11:45093700-45093722 GGGTGTGTATCTGTGTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081693414 Original CRISPR CTCCCACACCGCCGCTTCTG TGG (reversed) Intergenic
No off target data available for this crispr