ID: 1081698468

View in Genome Browser
Species Human (GRCh38)
Location 11:45136307-45136329
Sequence GCACACATTAATTTTAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 461}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081698468_1081698469 -9 Left 1081698468 11:45136307-45136329 CCTATTTTAAAATTAATGTGTGC 0: 1
1: 0
2: 4
3: 41
4: 461
Right 1081698469 11:45136321-45136343 AATGTGTGCCTAGTAAGCCAAGG 0: 1
1: 0
2: 1
3: 12
4: 172
1081698468_1081698471 4 Left 1081698468 11:45136307-45136329 CCTATTTTAAAATTAATGTGTGC 0: 1
1: 0
2: 4
3: 41
4: 461
Right 1081698471 11:45136334-45136356 TAAGCCAAGGTGAAGTGAAAAGG 0: 1
1: 0
2: 1
3: 32
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081698468 Original CRISPR GCACACATTAATTTTAAAAT AGG (reversed) Intronic
901103133 1:6734839-6734861 GCACAGATTAATTTTTACAGTGG - Intergenic
902533209 1:17103738-17103760 ACTCACACTAATTTTAAATTTGG + Intronic
903728046 1:25466620-25466642 AAACACACTGATTTTAAAATGGG - Intronic
904227381 1:29034304-29034326 ACACACGTTAATATGAAAATGGG + Intronic
905752828 1:40480804-40480826 GCACACATTATGATTAAAATTGG - Intronic
906377433 1:45306461-45306483 ACAAAAATTAATTTTAAAAATGG + Intergenic
906968268 1:50481995-50482017 TTATACCTTAATTTTAAAATAGG - Intronic
907854230 1:58285811-58285833 TTCCATATTAATTTTAAAATAGG - Intronic
908183741 1:61631805-61631827 AAACATATAAATTTTAAAATGGG + Intergenic
908702162 1:66913574-66913596 ACAAAAATTAATTTTAAAAATGG + Intronic
909115016 1:71522666-71522688 GCCCTCATGAATTGTAAAATGGG + Intronic
909682506 1:78308420-78308442 ACACACATAATTTTTAACATCGG - Intronic
910003235 1:82362057-82362079 GCCCACATTCATTTGGAAATAGG + Intergenic
910003239 1:82362096-82362118 GCCCACATTCATTTGGAAATAGG + Intergenic
910003243 1:82362135-82362157 GCCCACATTCATTTGGAAATAGG + Intergenic
910130906 1:83904202-83904224 ACACAAATTAATTTAAAAAATGG - Intronic
910276855 1:85458575-85458597 CCACACACACATTTTAAAATGGG + Intronic
911842906 1:102707068-102707090 GTCCTCATGAATTTTAAAATAGG + Intergenic
912082718 1:105957389-105957411 GCACATAATTATTTTAAAAATGG - Intergenic
912115791 1:106406174-106406196 GCAAACATTGATTTTGAAAAAGG + Intergenic
913064777 1:115240604-115240626 GTATAAAATAATTTTAAAATCGG + Intergenic
913487639 1:119348083-119348105 ACAAAAATTAATTTTAAAAATGG - Intergenic
914114384 1:144729956-144729978 ACATACATTAATTTTAACACAGG + Intergenic
914243495 1:145868712-145868734 GCACACATTATGATTAAAAGTGG + Intronic
916695855 1:167235642-167235664 GTACACATAATTTTTAAAAAAGG + Intronic
918412671 1:184276334-184276356 GAACAACCTAATTTTAAAATGGG + Intergenic
918498164 1:185162827-185162849 GCATATGTTAATTTAAAAATAGG + Intronic
918908783 1:190536985-190537007 GCATCCATTCATTTTTAAATGGG + Intergenic
918920498 1:190703648-190703670 GTACACAGTAATTTGAAAACAGG + Intergenic
919591264 1:199505789-199505811 ATACTCATTAATTTAAAAATAGG + Intergenic
919685595 1:200480499-200480521 CCACACACAAATTTAAAAATGGG - Intergenic
920058476 1:203211234-203211256 ACACACCTTAATTATAAACTAGG - Intergenic
921547981 1:216495841-216495863 GAACACATTCATTTAAAAAATGG + Intergenic
921727790 1:218543048-218543070 ACACACTTTACTTTTAAAATTGG - Intergenic
921939504 1:220825338-220825360 GGAAAAATTAATTTTAACATAGG - Intergenic
922133565 1:222803028-222803050 AAACACATTAATTTTAGATTTGG + Intergenic
922381190 1:225028616-225028638 AAACAAGTTAATTTTAAAATGGG + Intronic
922888875 1:229045096-229045118 TAACTCATTATTTTTAAAATGGG + Intergenic
923297294 1:232607115-232607137 GAACATATTAATTTTATAATAGG - Intergenic
924485354 1:244478116-244478138 ACATACAATAACTTTAAAATAGG - Intronic
924807224 1:247371266-247371288 AGACACTTTAATTTTAGAATAGG - Intergenic
1063898822 10:10710909-10710931 ACTCACCTTAATTTTAAAATGGG - Intergenic
1065374527 10:25024799-25024821 GCACAGATAAATTTTCGAATCGG - Exonic
1066605306 10:37160948-37160970 ACACATATTTATTTTAAAAATGG + Intronic
1067466872 10:46507063-46507085 ACACAACTCAATTTTAAAATGGG + Intergenic
1067620314 10:47877542-47877564 ACACAACTCAATTTTAAAATGGG - Intergenic
1068082067 10:52331456-52331478 GCACACAGTAATATTAATAATGG - Intergenic
1068297725 10:55096001-55096023 ACACACATTGATTTTCAGATAGG - Intronic
1068421205 10:56795870-56795892 GCAAACATTTATTCAAAAATGGG + Intergenic
1068614607 10:59099467-59099489 GCAAACCTTAATTTTATGATAGG - Intergenic
1069407127 10:68113535-68113557 GCCCAGATAACTTTTAAAATTGG - Intronic
1071217300 10:83422977-83422999 GCACACTTTATTTTTCAACTTGG - Intergenic
1071696314 10:87876955-87876977 TCACAGATTAATCTGAAAATTGG - Intronic
1073230628 10:101966551-101966573 GCCCACCCTAATTTTCAAATAGG + Intronic
1074501318 10:114027654-114027676 ACATGTATTAATTTTAAAATCGG - Intergenic
1075059805 10:119248175-119248197 CCACACAAAAATTTAAAAATTGG - Intronic
1075535018 10:123263666-123263688 GCACACATTTATTTTTACAGAGG + Intergenic
1075767437 10:124904829-124904851 GCCCACTCTAATTTTAAGATTGG - Intergenic
1075976731 10:126702541-126702563 GGACTCACTAATTTTATAATTGG + Intergenic
1076241809 10:128914487-128914509 TTACAAATCAATTTTAAAATGGG - Intergenic
1077954158 11:6995510-6995532 TCAGAAATTAATTTTAAAACTGG - Intergenic
1078387559 11:10906015-10906037 CCCCACATGAATTTTTAAATTGG + Intergenic
1078988371 11:16617195-16617217 GAACATATTATGTTTAAAATGGG + Intronic
1079514390 11:21249788-21249810 GCACACATTATGATTAAAATTGG - Intronic
1079754260 11:24235463-24235485 GCACATATAAAATTTAGAATCGG - Intergenic
1080066497 11:28021683-28021705 GCAAATGATAATTTTAAAATTGG - Intronic
1081104525 11:39048505-39048527 GCACTCATTATCTTTATAATAGG - Intergenic
1081551465 11:44116838-44116860 GGACAATTCAATTTTAAAATGGG - Intronic
1081558264 11:44187628-44187650 GGAAACATAAATTTTAGAATTGG + Intronic
1081698468 11:45136307-45136329 GCACACATTAATTTTAAAATAGG - Intronic
1081943630 11:46967762-46967784 GCAAAAAATAATCTTAAAATAGG + Intronic
1082716001 11:56614512-56614534 GCACAGATAATTTTTAAAAGGGG + Intergenic
1082776625 11:57250076-57250098 ACACTCATTAATTTTAGCATGGG + Intergenic
1083364885 11:62136102-62136124 GCTGACAATAATTTAAAAATTGG - Intronic
1084212679 11:67631149-67631171 GCACACAGTAATATTAAAAGTGG - Intergenic
1085191876 11:74633384-74633406 ACACACTTTAAGTATAAAATGGG - Intronic
1085887362 11:80536214-80536236 GCAAAAATTACTTTTAAGATGGG - Intergenic
1086694276 11:89824997-89825019 ACACTCAGTAATTTTAAATTAGG + Intergenic
1086702015 11:89908745-89908767 CCTCTAATTAATTTTAAAATAGG + Intergenic
1086704153 11:89935777-89935799 CCTCTAATTAATTTTAAAATAGG - Intergenic
1086711870 11:90019514-90019536 ACACTCAGTAATTTTAAATTAGG - Intergenic
1087321398 11:96663935-96663957 GCTCTAATAAATTTTAAAATAGG + Intergenic
1087493564 11:98860005-98860027 GCACACAGGAATTTTAAGGTAGG + Intergenic
1087622687 11:100560344-100560366 GAACACATTAACTTTCAGATGGG - Intergenic
1087977930 11:104573265-104573287 CCACTGATTTATTTTAAAATAGG + Intergenic
1088071338 11:105789438-105789460 GCATACATAAATGTTATAATTGG - Intronic
1088144745 11:106662912-106662934 CCACACACTAATGTTAAGATGGG + Intergenic
1088227605 11:107638698-107638720 GCAAATATTACTTGTAAAATGGG - Intronic
1088397034 11:109380216-109380238 GCATACATTTGTTTTTAAATGGG + Intergenic
1089034161 11:115368187-115368209 CCACACCTGAATTTTAAAAACGG - Intronic
1089878032 11:121744870-121744892 GAATACTTTAATTTTAATATAGG + Intergenic
1091609595 12:1994433-1994455 CCTCCCATCAATTTTAAAATTGG - Intronic
1092802388 12:12182866-12182888 GCACACATGAAATTCAAAACTGG + Intronic
1092873991 12:12832398-12832420 CCACAGATGCATTTTAAAATGGG + Intergenic
1092998238 12:13971355-13971377 GTTCACATTTATTTTAAAACAGG + Intronic
1093151095 12:15622556-15622578 GCACATTTTAAGTCTAAAATAGG + Intronic
1093219980 12:16408540-16408562 GCAAAGATTAATTTTAAAAGAGG - Intronic
1093226303 12:16487919-16487941 TTAAACATTAATTTAAAAATTGG + Intronic
1093718995 12:22415923-22415945 GCCCACATTCATTTTGGAATGGG - Intronic
1094287452 12:28811372-28811394 GCTCTCATTAATTTTATACTTGG - Intergenic
1094727527 12:33135578-33135600 ATACATATTAACTTTAAAATGGG + Intergenic
1095132571 12:38561378-38561400 GAAAACATTTATTTTAAAAATGG + Intergenic
1095268863 12:40192999-40193021 ACAAAAATTAATTTTAAAAATGG - Intergenic
1096034366 12:48451980-48452002 TTCCACATGAATTTTAAAATAGG - Intergenic
1097497745 12:60363332-60363354 GCAAATATAAATTTTAAAAAGGG - Intergenic
1097978381 12:65711835-65711857 GCACACATTCTATTTAGAATTGG + Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098240263 12:68460112-68460134 GCACAGAAGAATTTGAAAATAGG - Intergenic
1098283259 12:68883052-68883074 GGCCACACTATTTTTAAAATGGG - Intronic
1098719786 12:73881977-73881999 GCACAAACTAATATTAAACTGGG - Intergenic
1099059939 12:77895276-77895298 GGACATTTTAATTTTAAAATAGG + Intronic
1099417006 12:82402461-82402483 GCAAATATTAGTTGTAAAATGGG + Intronic
1099629269 12:85119847-85119869 GCACAAACTAATTTAAAAATAGG - Intronic
1099653791 12:85463428-85463450 ACAAAAATTAATTTTAAAAAGGG - Intergenic
1099925871 12:89016312-89016334 CCACATTTTTATTTTAAAATCGG + Intergenic
1100280005 12:93109328-93109350 GCACAGATTCATTTTAGAAAAGG - Intergenic
1101867801 12:108534740-108534762 GCACACAGTGTTTTTTAAATAGG + Intronic
1102606930 12:114075036-114075058 GCTCAGTTTAACTTTAAAATGGG - Intergenic
1105557069 13:21457646-21457668 GTACAAAGTAATTTTAAAACTGG + Intronic
1105661247 13:22497911-22497933 GCACAGATTATTTTTAAAGCTGG - Intergenic
1105832789 13:24179411-24179433 GCACACATCAGTTTAAAAACTGG - Intronic
1106659776 13:31786690-31786712 AGACACATTTATTTTTAAATGGG + Intronic
1106924847 13:34602985-34603007 GCAAACATAAATATTTAAATAGG - Intergenic
1107703998 13:43081022-43081044 ACATACAGTATTTTTAAAATAGG - Intronic
1107771591 13:43793072-43793094 ACACACACTACTTTTACAATTGG - Intergenic
1108191677 13:47947381-47947403 ACAAACATTATTTTGAAAATTGG + Intronic
1108302014 13:49087761-49087783 ACACATATTTATTTTATAATTGG - Intronic
1108364845 13:49699675-49699697 GCACACATTATGATTAAAATTGG - Exonic
1108800839 13:54092765-54092787 GCACACAGTAATTGGAAAAGTGG - Intergenic
1109045349 13:57404018-57404040 GCACACATTATTCTTATGATTGG + Intergenic
1109462002 13:62673119-62673141 TCCCATATGAATTTTAAAATAGG + Intergenic
1109766623 13:66908948-66908970 ATACACATTAATTTAAAAACAGG + Intronic
1109995238 13:70114880-70114902 TCATACGTTAATTTTAAAATAGG - Intergenic
1110722209 13:78775804-78775826 GAACACAGTACTTTTAAATTTGG + Intergenic
1110766613 13:79286794-79286816 GCACACTCAAATTTTCAAATTGG + Intergenic
1111418570 13:87978829-87978851 GCTTACATCTATTTTAAAATAGG + Intergenic
1111845203 13:93498774-93498796 GCACACATATATTTACAAATGGG - Intronic
1112004130 13:95239737-95239759 TCACTCATTATTTTGAAAATCGG + Intronic
1112724166 13:102282687-102282709 ACAAAAATTATTTTTAAAATGGG - Intronic
1114942479 14:27631267-27631289 GCACACATTTTTTTTAAAATAGG - Intergenic
1115638750 14:35317497-35317519 TCAAAAATAAATTTTAAAATAGG - Intergenic
1115874893 14:37849849-37849871 GCACAACTTAGTTTTATAATAGG + Intronic
1116510465 14:45739252-45739274 AAACACAGTTATTTTAAAATGGG - Intergenic
1117133856 14:52713432-52713454 ACACAAAATAATTCTAAAATGGG - Intronic
1118318560 14:64740269-64740291 GCAAACACTAATTATAAGATCGG - Intronic
1118871510 14:69746903-69746925 GCAAAAATTAATTTTAAAAATGG - Intronic
1120456333 14:84735689-84735711 TCACCCATTAATTCTACAATTGG - Intergenic
1120628626 14:86860615-86860637 GCTCACATTAATCTTAGAGTTGG + Intergenic
1120714397 14:87824579-87824601 GAAAACATTAATTTTCAAATAGG - Intergenic
1123159313 14:106262695-106262717 ACACAATTTAATTTTAAAATGGG - Intergenic
1123160429 14:106273570-106273592 ACAGAATTTAATTTTAAAATGGG - Intergenic
1123178947 14:106449210-106449232 ACACAAATTAATTTTAAAATGGG - Intergenic
1123455657 15:20421793-20421815 GCACACATGAAAATTAACATGGG - Intergenic
1126212625 15:46117084-46117106 GCAAAAACTAATTTAAAAATGGG + Intergenic
1126736349 15:51735637-51735659 CTACACTTTAATTTTAAAAAGGG + Intronic
1127752262 15:62057650-62057672 GCCAACATTAACTTTATAATAGG - Intronic
1128644628 15:69367306-69367328 TAACACATTAATTATAAAACAGG - Intronic
1128870315 15:71150239-71150261 CCAAACATTAATTTTGAATTGGG + Intronic
1128965997 15:72058276-72058298 GTATACATATATTTTAAAATGGG + Intronic
1129446349 15:75621424-75621446 GTACCAATAAATTTTAAAATTGG - Intronic
1129530700 15:76261977-76261999 GCACACAAGGATTTTAAAGTAGG + Intronic
1130718287 15:86358850-86358872 ACACAACTTAATTTAAAAATGGG - Intronic
1130950933 15:88587110-88587132 GCTCACACTAATTTTGAATTAGG - Intergenic
1131036887 15:89228394-89228416 GCACAAAATAATTATAAAATAGG + Intergenic
1131812291 15:96185174-96185196 CTACACATTTATTTAAAAATTGG - Intergenic
1133086769 16:3370604-3370626 GCTCTAATTAATTTTAATATAGG - Intronic
1133394287 16:5433610-5433632 GCATACATTATTTTTGTAATTGG - Intergenic
1135714146 16:24746492-24746514 CTACACAGTAATTTTAAAGTGGG - Intronic
1135784220 16:25333983-25334005 GCACCGATAAAATTTAAAATGGG - Intergenic
1136135822 16:28256328-28256350 GCATGCATTCATTTTCAAATTGG - Intergenic
1136703721 16:32167907-32167929 TTAAACATTAATTTTAAATTAGG + Intergenic
1137261404 16:46832780-46832802 ACACACGTTGATGTTAAAATTGG + Intergenic
1139807235 16:69577478-69577500 GAACACAGTATTTTTAAAACTGG - Intronic
1140639016 16:76950174-76950196 GCAAACATTATTTATAAAAGAGG + Intergenic
1203066335 16_KI270728v1_random:1021821-1021843 TTAAACATTAATTTTAAATTAGG - Intergenic
1143969100 17:10780047-10780069 CAACAAAATAATTTTAAAATGGG - Intergenic
1144177870 17:12725118-12725140 GCGCACATTTATTTTATAACTGG + Intronic
1147015018 17:37484840-37484862 GTAAATCTTAATTTTAAAATGGG - Intergenic
1147539537 17:41345629-41345651 TCACTCATTAATTCCAAAATTGG - Intergenic
1148681810 17:49478387-49478409 GCTCAAGTTAATTTGAAAATGGG + Intergenic
1149129682 17:53283457-53283479 GCACACATGAATATAAACATGGG - Intergenic
1149227007 17:54483853-54483875 GCACACATGAATTTGAAAAAGGG + Intergenic
1149248892 17:54745046-54745068 GCCTGCAGTAATTTTAAAATTGG + Intergenic
1149409969 17:56395091-56395113 GCCTACATTATTTTTATAATTGG - Intronic
1150120685 17:62599224-62599246 GCAGACATTTGTTTTCAAATAGG + Intronic
1150582526 17:66487844-66487866 TCACTCAACAATTTTAAAATGGG - Intronic
1150910513 17:69382495-69382517 TTTCTCATTAATTTTAAAATAGG - Intergenic
1151236850 17:72726808-72726830 GCAAACATATATCTTAAAATTGG + Intronic
1151289287 17:73137471-73137493 GCACACATTGCTTTTGCAATAGG - Intergenic
1152187652 17:78868087-78868109 GCACACATTGATTTTTAGAAGGG + Intronic
1152884161 17:82839112-82839134 GCTTACATGAAGTTTAAAATTGG - Intronic
1152940033 17:83164290-83164312 GAACAACTTGATTTTAAAATGGG - Intergenic
1153358616 18:4167328-4167350 GCAAACACTAATTAAAAAATAGG + Intronic
1154209037 18:12363311-12363333 CTACAAATTATTTTTAAAATAGG + Intronic
1155084396 18:22442909-22442931 ACACAAACTGATTTTAAAATGGG + Intergenic
1155903801 18:31424807-31424829 GCACATGTTAATTTTATACTGGG - Intergenic
1158385261 18:56982225-56982247 ACACACATTACTTTAAAATTTGG + Intronic
1158813753 18:61069557-61069579 GTAAAAATTAATTTTAAAAAGGG - Intergenic
1158921932 18:62202600-62202622 ACACACTTTAATTTTCAACTTGG - Intronic
1159669309 18:71203362-71203384 CCACACATTTATTATAAAACAGG + Intergenic
1159706113 18:71690729-71690751 TCACAGATTATTTTTTAAATAGG - Intergenic
1159869702 18:73746484-73746506 GCAAATACAAATTTTAAAATAGG - Intergenic
1160936023 19:1595186-1595208 GCCAAGATTATTTTTAAAATTGG + Intergenic
1165222215 19:34325641-34325663 GCTCGCCTTCATTTTAAAATTGG + Intronic
1165348038 19:35261294-35261316 TCACACATTTTTTTTAAAACAGG - Intronic
1167775800 19:51553927-51553949 ACAGAGATTAATTTAAAAATTGG - Intergenic
1168184194 19:54687337-54687359 GCACACATTAAGTATCTAATGGG - Intronic
925831513 2:7900555-7900577 GCAGAAATTAATTTTGAAGTTGG - Intergenic
925837154 2:7957411-7957433 GCACATATTACTTTTACAATTGG + Intergenic
925935377 2:8752754-8752776 GCATATATTACTTTTACAATAGG - Intronic
926260269 2:11253730-11253752 GCAAAAATTTATTTTAAAAGTGG + Intronic
928438194 2:31269610-31269632 GCAAAAATAAATTTTAAAAGTGG + Intergenic
928994204 2:37269565-37269587 GTACACATTATTTTAAAAACTGG - Intronic
932298647 2:70647447-70647469 GCATGCATTAATTTTAAAAATGG + Intronic
933045968 2:77537971-77537993 GCACATATTAATTTAGTAATTGG - Intronic
934920803 2:98343778-98343800 GTACACATTGCTTTAAAAATAGG - Intronic
935101891 2:100003861-100003883 GTCCAAATTAAGTTTAAAATTGG - Intronic
935383943 2:102481944-102481966 GCACAGATTATTTTTCAAAGGGG - Intronic
935402735 2:102677459-102677481 CCACACATTTATGTTAAAGTGGG + Intronic
935458433 2:103298464-103298486 GCACACTTTGATTTTAAAATGGG + Intergenic
935495715 2:103778384-103778406 GATGACATCAATTTTAAAATTGG + Intergenic
935501956 2:103852231-103852253 GCACACATTATTTTTTTCATTGG - Intergenic
938090646 2:128431573-128431595 GCAAACATTAATTTTTTAAAGGG - Intergenic
939077283 2:137618998-137619020 GAACCCATTAATTTGAAACTTGG - Intronic
939159617 2:138571655-138571677 GCATACATTACTTTCAAAATAGG + Exonic
939589750 2:144049922-144049944 GCACATAGTAAGTTTATAATTGG + Intronic
940246112 2:151618085-151618107 GCACACAGTACTTTTAACAATGG + Intronic
940734187 2:157430247-157430269 GCACACATTCTCTTTAAACTGGG - Intronic
941607220 2:167613574-167613596 GCATCCATTAATTTAAAAATTGG - Intergenic
942121694 2:172784127-172784149 GCACACACAAAGTTAAAAATGGG - Intronic
942495598 2:176536701-176536723 GGGCACATTGATTTTAATATTGG + Intergenic
942503593 2:176618228-176618250 AAACGCATTAATTTTATAATAGG - Intergenic
943425083 2:187721421-187721443 TTCCACATAAATTTTAAAATAGG + Intergenic
943888257 2:193251009-193251031 AAACAACTTAATTTTAAAATTGG + Intergenic
944788709 2:203101494-203101516 TTCCATATTAATTTTAAAATAGG + Intronic
945327519 2:208499642-208499664 GCAGAGATTAATATTAAAACTGG + Intronic
945964302 2:216169694-216169716 TCCAGCATTAATTTTAAAATAGG - Intronic
947012150 2:225578234-225578256 TCACACCTTCATTTTAAAGTTGG + Intronic
947183899 2:227437661-227437683 GAAAACAATATTTTTAAAATGGG - Intergenic
1170182793 20:13551830-13551852 GCAAACAATAAATTTAAAACAGG + Intronic
1172218350 20:33252442-33252464 GCACACATTGAATCTAAAACAGG + Intergenic
1174445103 20:50585660-50585682 GCACACATTCAGTTCACAATAGG + Intergenic
1174837840 20:53875016-53875038 GCACACATAATTTTTATAAAAGG + Intergenic
1175360889 20:58411639-58411661 GAACAACCTAATTTTAAAATGGG - Intronic
1176298619 21:5087951-5087973 GCACACACTGATGTTAGAATCGG - Intergenic
1176914194 21:14605170-14605192 GACCATATTAATTTTCAAATAGG + Intronic
1177413741 21:20767877-20767899 GCACACAACAATATTAAAATTGG - Intergenic
1177685338 21:24429000-24429022 AAACACATCATTTTTAAAATTGG + Intergenic
1177776275 21:25570310-25570332 GTACACATAAATGTTAAAGTGGG + Intergenic
1178573964 21:33768249-33768271 GTTCACATTAAATTTAAAATAGG - Intronic
1179807152 21:43846769-43846791 GCATTCCTTAACTTTAAAATGGG - Intergenic
1179858407 21:44173998-44174020 GCACACACTGATGTTAGAATCGG + Intergenic
1184574738 22:45354199-45354221 GCATAAAATATTTTTAAAATTGG + Intronic
949915532 3:8960683-8960705 GTAGACTTTATTTTTAAAATTGG - Intronic
950895125 3:16441971-16441993 GCAAACATTATTTTAAAAATTGG - Intronic
951215508 3:20020993-20021015 ACACAACTCAATTTTAAAATGGG + Intergenic
951480592 3:23158284-23158306 GGACACATGAAGTTTTAAATAGG + Intergenic
951516379 3:23564534-23564556 CCACACAAGCATTTTAAAATTGG + Intronic
952001940 3:28796157-28796179 GCACACATTTATTGTGAAAGTGG - Intergenic
952554356 3:34515056-34515078 GCCCTCTTTATTTTTAAAATGGG + Intergenic
952779900 3:37086036-37086058 ACACAAATCAATTTAAAAATGGG + Intronic
953065891 3:39470795-39470817 GCCCAAATTAATTTTTTAATAGG - Intronic
954587759 3:51751544-51751566 ACAAAAATTAATTTTAAAAATGG - Intergenic
956676318 3:71735968-71735990 GAACACCATGATTTTAAAATTGG + Intronic
956693573 3:71900033-71900055 GCATATATTACTTTTGAAATTGG - Intergenic
957009921 3:74992436-74992458 ATACATATTAATTTTAAATTAGG + Intergenic
957144113 3:76399931-76399953 GAATAAATTCATTTTAAAATTGG + Intronic
957159231 3:76587166-76587188 TCACACAGTTATTTTGAAATGGG - Intronic
957199795 3:77118520-77118542 TTACACAGTTATTTTAAAATTGG + Intronic
957410298 3:79831188-79831210 TAATACTTTAATTTTAAAATAGG + Intergenic
957459051 3:80493905-80493927 CCACAAATTATTTTTAAAAGAGG + Intergenic
958972690 3:100630215-100630237 GCACACCTCAAATTTAAAAATGG - Intronic
959265879 3:104138192-104138214 GCACATAAAAATTTTTAAATTGG - Intergenic
959375362 3:105582938-105582960 GCACACATTAAAGAGAAAATGGG + Intergenic
959892073 3:111568282-111568304 CTACACATCATTTTTAAAATTGG - Intronic
960035542 3:113098902-113098924 ACTCACATTTATTTCAAAATTGG + Intergenic
960206617 3:114908666-114908688 GTACGCATTAAGTTCAAAATAGG + Intronic
960485498 3:118247562-118247584 ACAGAAATTATTTTTAAAATAGG + Intergenic
960887017 3:122406095-122406117 ACATATATTACTTTTAAAATTGG - Intronic
961322579 3:126085875-126085897 ACAAAAATTAATTTTAAAAATGG + Intronic
962354254 3:134680263-134680285 ACACACATACATTTTAAACTCGG + Intronic
962917579 3:139918533-139918555 GCACTCATAAATTTTTTAATTGG - Intergenic
964509102 3:157430905-157430927 GCACACATTGATTTTAACTTAGG - Intronic
964615953 3:158665175-158665197 GCTCACATTGTTTTTAAAAATGG + Intronic
965219365 3:165906822-165906844 TCACAGATTTTTTTTAAAATAGG - Intergenic
965357008 3:167688029-167688051 GCAAAGAAAAATTTTAAAATGGG - Intronic
966049316 3:175594187-175594209 GCACACATGAATATAAACATGGG - Intronic
967160156 3:186729014-186729036 GCATGCATTTATTTTATAATTGG + Intronic
967479495 3:189957344-189957366 GCACAGGTTAATTTTAGAACTGG + Exonic
968157036 3:196390051-196390073 CCACAAAATATTTTTAAAATTGG + Intronic
968349297 3:198039448-198039470 GCTGCCATTAAATTTAAAATAGG - Intronic
968403164 4:316239-316261 TCAGACATTAATTTTCAATTAGG - Intergenic
970762675 4:19510193-19510215 GCGCCTATTAATTTTAAAAGGGG + Intergenic
971131171 4:23812710-23812732 GCTCACTTTTATTTTAAAGTAGG - Intronic
971909673 4:32779291-32779313 GCAATCATCAATATTAAAATTGG + Intergenic
971960280 4:33477777-33477799 GCACACATGAAAAATAAAATAGG - Intergenic
972156943 4:36175085-36175107 GCTTACTTTTATTTTAAAATGGG - Intronic
972383993 4:38546004-38546026 GCAAACATTAACATTAACATGGG - Intergenic
972790378 4:42365933-42365955 TTACACATTTATTTTAAAAAAGG - Intergenic
973966514 4:56168442-56168464 GCAAGCATTAAGTTAAAAATTGG - Intergenic
975793891 4:77984867-77984889 GCTGACCTTAATATTAAAATTGG - Intergenic
976048975 4:80988092-80988114 GAACACATTAATTAATAAATAGG - Intergenic
977210523 4:94212775-94212797 CCACACCTTTATTTTAAAATAGG + Intronic
977301903 4:95277355-95277377 GCACACATTAATTTGACAAGTGG - Intronic
977685314 4:99840609-99840631 GCACACAATTTCTTTAAAATGGG + Intronic
977799274 4:101206245-101206267 TCACACATCTATTTAAAAATTGG + Intronic
977962287 4:103099672-103099694 GCTCAGATTAATTTTGAAACAGG + Intronic
978243513 4:106545119-106545141 CAAAAAATTAATTTTAAAATGGG + Intergenic
978474173 4:109107066-109107088 GCACTTATTAAATTTTAAATGGG - Intronic
978826064 4:113025410-113025432 ACACACATTTATTTTGAAGTAGG + Intronic
979571427 4:122230773-122230795 GCACATATTAAATATACAATGGG - Intronic
979645938 4:123069032-123069054 GAACACAATAAATTTAAAAGTGG + Intronic
979802804 4:124931948-124931970 GCATGCATTATTTTTAAAATGGG + Intergenic
980145156 4:128973591-128973613 TCACACATGAATATTAAATTGGG - Intronic
980175791 4:129342502-129342524 GCACACATTAAAATTGGAATGGG + Intergenic
980623920 4:135346237-135346259 TCAGTCATTATTTTTAAAATAGG - Intergenic
981363981 4:143879999-143880021 TATCCCATTAATTTTAAAATGGG - Intronic
981374706 4:144000773-144000795 TATCCCATTAATTTTAAAATGGG - Intronic
981385038 4:144120079-144120101 TATCCCATTAATTTTAAAATGGG - Intronic
981436127 4:144724250-144724272 GCACCTATTTATTTTGAAATAGG - Intronic
981594968 4:146409621-146409643 TTATACCTTAATTTTAAAATCGG + Intronic
981598442 4:146455248-146455270 ACAGAAATTAACTTTAAAATGGG + Intronic
982356844 4:154479778-154479800 TCAAACATTAATTTATAAATTGG + Intronic
982436370 4:155385797-155385819 GTAAACATTTATTTTAAAACAGG - Intergenic
982469012 4:155763657-155763679 AGACACATTAATTTCAAAACTGG - Intronic
982867352 4:160531802-160531824 GCAAAAACTAATTTTAAAAATGG - Intergenic
982958106 4:161796996-161797018 TCAAACATTAATTTTTGAATTGG + Intronic
983643244 4:169963386-169963408 ACACACATACATTTTAAATTTGG + Intergenic
984185008 4:176533089-176533111 AAACACCTTAATTTTAAATTGGG + Intergenic
984277754 4:177630137-177630159 GAACAAATTAATTCTAAAATAGG - Intergenic
984286307 4:177733682-177733704 TCTCATATTAATTTTAAAAAGGG - Intronic
984402430 4:179283882-179283904 TGATACATTATTTTTAAAATGGG - Intergenic
985150017 4:186937409-186937431 GTAAACACTAAATTTAAAATAGG - Intergenic
988018562 5:25593809-25593831 ATACACCTTAATTTAAAAATAGG + Intergenic
988271075 5:29017519-29017541 GCACATTTGAATGTTAAAATGGG + Intergenic
988318859 5:29666929-29666951 ACACAGATAAATTTTTAAATGGG + Intergenic
989222285 5:38980903-38980925 GAAAACTGTAATTTTAAAATTGG - Intronic
990964651 5:61432023-61432045 GAAGACATGAATTTTAAAAATGG - Intronic
990974928 5:61551498-61551520 GCTAAAATGAATTTTAAAATGGG + Intergenic
991182775 5:63773411-63773433 GCACAAGTTATTTTTAATATTGG + Intergenic
991478634 5:67051419-67051441 GCCCACATTAATAATAACATTGG - Intronic
992060563 5:73041533-73041555 GGACATTTTACTTTTAAAATTGG + Intronic
992061466 5:73052254-73052276 TCACACATTTATTTTAAAAAAGG - Intronic
993097878 5:83501783-83501805 TCCCACATGAATTTTAAAATTGG + Intronic
993238114 5:85342456-85342478 ACACACATTATTTTTATAGTAGG + Intergenic
993283792 5:85962758-85962780 GCACACACTGATTTTGGAATAGG - Intergenic
993766009 5:91859505-91859527 GCACACTAAAATTTTAACATTGG + Intergenic
993804691 5:92390588-92390610 ACATATATTAATTTTAACATAGG + Intergenic
993853878 5:93047193-93047215 GCATTCATTAAGTTTAAATTTGG + Intergenic
994009708 5:94886911-94886933 GTAAAAATTATTTTTAAAATTGG + Intronic
994274859 5:97823161-97823183 GCACACATTAAGTTAATATTAGG + Intergenic
994293254 5:98055838-98055860 GCACAAATCCATTTTAAAATAGG + Intergenic
994544860 5:101152764-101152786 TCACAATTTAATTTAAAAATGGG - Intergenic
995402039 5:111753909-111753931 GCACATATTAATGTAAAAAAAGG - Intronic
995408085 5:111824602-111824624 GGGCACATTTATGTTAAAATTGG + Intronic
995731484 5:115247712-115247734 TCACACATTTGTTTTAGAATTGG + Intronic
996034948 5:118748565-118748587 GTACAAACTAATTTTAAAAAGGG - Intergenic
996076465 5:119200565-119200587 TTCCATATTAATTTTAAAATAGG + Intronic
996675155 5:126166892-126166914 GCCCACAATAATTTGAAATTTGG + Intergenic
996888344 5:128386518-128386540 TTCCACATGAATTTTAAAATAGG + Intronic
997781094 5:136659401-136659423 GCTTACATTCATTTTAACATGGG - Intergenic
999686609 5:154108701-154108723 GCACACTTTAAGCTAAAAATGGG - Intronic
999801196 5:155038753-155038775 AGACACAATAATATTAAAATAGG - Intergenic
1000380128 5:160621447-160621469 TCCCACATTAACTTGAAAATTGG + Intronic
1000645716 5:163757885-163757907 GCAAACAATCATTTTAACATGGG - Intergenic
1001201739 5:169723934-169723956 GCACTCATTAAGTATGAAATTGG + Intronic
1001352095 5:170979123-170979145 GCACATATTATTTTTACCATAGG - Intronic
1001975120 5:175992441-175992463 CAACTCAATAATTTTAAAATGGG + Intronic
1002242313 5:177851334-177851356 CAACTCAATAATTTTAAAATGGG - Intergenic
1003021387 6:2512844-2512866 AGAGACATTAAATTTAAAATCGG - Intergenic
1003046840 6:2740991-2741013 ACACACATAAGTTTTAAAAACGG - Intronic
1004786171 6:18970010-18970032 CCAAAAATTAATTTTTAAATAGG - Intergenic
1005188143 6:23185775-23185797 ACAAAAATTCATTTTAAAATAGG + Intergenic
1006974145 6:38081556-38081578 TTACACATTTATTTTAAAAAGGG - Intronic
1007051349 6:38833762-38833784 GCACACAGTAATTCATAAATTGG - Intronic
1008052120 6:46910874-46910896 GCACTCAATAATTTCAAAATTGG + Intronic
1008074515 6:47131718-47131740 CAACACTTTAAATTTAAAATAGG - Intergenic
1008234177 6:49024561-49024583 TCACATATTAATATTAAATTTGG - Intergenic
1008759124 6:54832971-54832993 GGCCAGATTAAATTTAAAATGGG + Intergenic
1009094688 6:58963216-58963238 TCACACATTAGTTTCAAAAATGG - Intergenic
1009428082 6:63536584-63536606 TCATACATCAATTTTAAAACAGG - Intronic
1010109209 6:72204610-72204632 GCAAACATTAAGAATAAAATTGG - Intronic
1010168323 6:72943135-72943157 CCACACATTTAATTTAAAAAAGG - Intronic
1010275481 6:73963884-73963906 GAAGACAGTAATTTTGAAATTGG - Intergenic
1010841877 6:80656110-80656132 GCCAACATTGATTTTAAAACTGG - Intergenic
1011277859 6:85646780-85646802 ACATATATTAATTTTATAATGGG + Intergenic
1011924192 6:92622105-92622127 GCCCTCATTACTTTTAAATTAGG - Intergenic
1011929001 6:92686224-92686246 ACATATATTAATATTAAAATTGG - Intergenic
1012573144 6:100757089-100757111 GAACATTTTAATTTTGAAATTGG - Intronic
1012811023 6:103958284-103958306 TCATAAATTAATTGTAAAATAGG + Intergenic
1013789185 6:113816463-113816485 ACACACATCAATTGTAGAATGGG + Intergenic
1015016760 6:128422867-128422889 GCATACAGTCATCTTAAAATAGG + Intronic
1015258944 6:131212345-131212367 AGAAACATTCATTTTAAAATTGG + Intronic
1015649081 6:135434100-135434122 GAACATATTAATTTTAAATATGG + Intronic
1016134400 6:140521030-140521052 GTACACATTAAGTATCAAATGGG + Intergenic
1016243754 6:141959946-141959968 GCAAAAATTTATTTAAAAATGGG + Intergenic
1016909759 6:149186277-149186299 GCACATATGAATTTCAGAATTGG + Intergenic
1017033606 6:150247030-150247052 ACACATATTACTTTTATAATAGG + Intronic
1017357826 6:153530531-153530553 GCACACATGAACATTAATATGGG - Intergenic
1018876115 6:167824880-167824902 CCACACTTTAATTTTAAGAAAGG + Intergenic
1019328042 7:448372-448394 GCAAACATTATTTTTTAAAATGG + Intergenic
1020497984 7:8880072-8880094 CCAGACATTAATTTTAGAATAGG - Intergenic
1020915066 7:14183355-14183377 GAAGACATAAATTTTAAAAGGGG + Intronic
1022329595 7:29364951-29364973 GTACACATTCATTTTAAGAAAGG - Intronic
1022766148 7:33414524-33414546 GCATGCATTATTTTAAAAATTGG + Intronic
1023642350 7:42272632-42272654 TCAAAAATTTATTTTAAAATTGG + Intergenic
1023781254 7:43657821-43657843 GAACAACTTAATTTGAAAATGGG + Intronic
1023990709 7:45126628-45126650 ACACGCATTACTTTCAAAATGGG - Intergenic
1024683728 7:51721492-51721514 GCCCACATTAATTTTGCATTTGG + Intergenic
1027916873 7:84335755-84335777 GCCCACATTATATTTCAAATAGG - Intronic
1028076822 7:86526642-86526664 CCACACATTTATTTTCAAAAAGG + Intergenic
1028443467 7:90891356-90891378 GAACACATTGTTTTAAAAATGGG - Intronic
1028596449 7:92551177-92551199 TAATACATTATTTTTAAAATGGG + Intergenic
1028642921 7:93063575-93063597 CCACAAATAATTTTTAAAATAGG - Intergenic
1029018794 7:97342189-97342211 GCACATATTCAATTTAGAATAGG - Intergenic
1030404004 7:109087805-109087827 CTTCACATGAATTTTAAAATAGG - Intergenic
1031245454 7:119305803-119305825 TTCCATATTAATTTTAAAATAGG + Intergenic
1031861765 7:126987921-126987943 ACACATGCTAATTTTAAAATTGG - Intronic
1032144284 7:129365012-129365034 GCATACATAAATTTTAAATTTGG + Intronic
1032244711 7:130200778-130200800 GCCAAAATTAATTTTAATATTGG + Intronic
1032932628 7:136691109-136691131 GCAGAGAATATTTTTAAAATTGG - Intergenic
1035123033 7:156584862-156584884 GCAAAAATTAATTTTAAAAATGG + Intergenic
1036924414 8:12890957-12890979 GCAATCATTAATTCCAAAATTGG - Intergenic
1038036745 8:23692553-23692575 GCAAATATTAATGATAAAATTGG - Intergenic
1038131352 8:24735238-24735260 TCACACAAAAATATTAAAATTGG + Intergenic
1038204905 8:25457669-25457691 GCAGACAGGATTTTTAAAATGGG - Intronic
1039262696 8:35789649-35789671 GCTCACATTAACTTAAAGATTGG + Intronic
1039508502 8:38070105-38070127 TCAAAAATAAATTTTAAAATAGG + Intergenic
1039660846 8:39462947-39462969 TAAAAAATTAATTTTAAAATGGG + Intergenic
1039840972 8:41292840-41292862 ACACACATTCATTTAAAAACAGG - Intronic
1040771671 8:50984906-50984928 TAACACTTTAATTTTAAAACAGG + Intergenic
1041486746 8:58385813-58385835 GAACAACTTAATTTAAAAATGGG - Intergenic
1041546897 8:59055719-59055741 AAACACTTTAATTTTAAAGTGGG + Intronic
1042081115 8:65052315-65052337 GCACACATCAGTTTTGAAATGGG - Intergenic
1042669736 8:71247923-71247945 TGGCACATAAATTTTAAAATTGG - Intronic
1043057961 8:75464070-75464092 GGACACATTGACTTTAAAGTTGG + Intronic
1043835915 8:85045711-85045733 GCACACATTAACATAAACATGGG - Intergenic
1044568053 8:93686872-93686894 GGTCACACTAATTTTAAAAAAGG - Intergenic
1044985259 8:97751422-97751444 GCACACCTTCTTTATAAAATGGG - Intergenic
1045758927 8:105580348-105580370 GAAAACTTTAATTTTGAAATAGG - Intronic
1045995286 8:108354914-108354936 GCATAGATTCATTTGAAAATTGG + Intronic
1046198864 8:110895251-110895273 GAACAGATTTATTTTTAAATGGG + Intergenic
1046374693 8:113361268-113361290 TCATACATTAATTTTAAAAATGG + Intronic
1046588778 8:116180454-116180476 GTACAAATTAATTTTTTAATTGG - Intergenic
1046623335 8:116551068-116551090 ACACACATTTATTTTTAAAAAGG - Intergenic
1047346282 8:124031822-124031844 GTACACATGAAATTAAAAATGGG + Intronic
1047633507 8:126733996-126734018 GCAGAAATAAATTTTAAAAAGGG - Intergenic
1047846490 8:128811600-128811622 GCACACCTGAATTTAATAATGGG + Intergenic
1049131350 8:140845824-140845846 GCACACATTAATTTCATTATTGG + Intronic
1050248888 9:3722593-3722615 CCACTCCTTAATTTGAAAATTGG - Intergenic
1051164321 9:14245894-14245916 GTACACATAAATTATAAAAGTGG + Intronic
1051742224 9:20263118-20263140 GTACACATGAGTTTTGAAATGGG - Intergenic
1051996302 9:23221731-23221753 GCACAAATTTTTTTAAAAATGGG - Intergenic
1052120451 9:24709240-24709262 CCAACCATTATTTTTAAAATTGG + Intergenic
1052252945 9:26421423-26421445 CCACAAATTCTTTTTAAAATGGG + Intergenic
1052577457 9:30308114-30308136 GCACACACTAATTTAAAAAAAGG + Intergenic
1052583427 9:30391747-30391769 ACAGACTTTAATTTTAAAAAGGG + Intergenic
1052718641 9:32148264-32148286 GCACACATGAATATAAATATGGG - Intergenic
1052802477 9:32982508-32982530 GAAAACATTACTTTTACAATAGG + Intronic
1053410485 9:37913341-37913363 GTACACATTAATTTTATAATTGG + Intronic
1055532708 9:77201792-77201814 GCAGAAATTAGTTTTCAAATCGG - Intronic
1055533729 9:77214813-77214835 GCATCCATTACTTTTACAATCGG + Intronic
1056019659 9:82428483-82428505 GCAAACATTAATGCTTAAATTGG - Intergenic
1056888353 9:90466266-90466288 GCACACCTAAATTTAAAAAAGGG + Intergenic
1057072177 9:92108527-92108549 GCAAACATTAATGCTTAAATTGG + Intronic
1057157515 9:92856491-92856513 GAACAAAATAATTTTAAAAATGG + Intronic
1057235732 9:93357714-93357736 ACAAAAATTAATTTTAAAAATGG + Intergenic
1057453758 9:95189202-95189224 GGACATATAAATTTTAAAAAGGG - Intronic
1057698293 9:97343173-97343195 CCACACAGTGCTTTTAAAATTGG - Intronic
1057977859 9:99625561-99625583 GCCCACATGAATCTTAAAAATGG + Intergenic
1058629556 9:106972479-106972501 GAACAAATGAGTTTTAAAATTGG + Intronic
1059511912 9:114856305-114856327 TAACACATGAATTTTAAATTTGG + Intergenic
1061756286 9:132814751-132814773 ACACCCATTAAATTTTAAATAGG + Intronic
1185940412 X:4312493-4312515 GTACACACAAATTCTAAAATAGG - Intergenic
1185967666 X:4625714-4625736 GCATACCACAATTTTAAAATTGG + Intergenic
1187781345 X:22829424-22829446 GAATAACTTAATTTTAAAATGGG + Intergenic
1187783367 X:22855161-22855183 ACAAACCTTAATTTTCAAATAGG + Intergenic
1188120058 X:26294035-26294057 AGACAGATTAAATTTAAAATTGG + Intergenic
1188142379 X:26567728-26567750 GTAAACATTATTTTTAAAATAGG - Intergenic
1188299689 X:28493041-28493063 GCAAACATTAATTGTTAAAAAGG - Intergenic
1189009517 X:37032714-37032736 GCAGACATTTATTTTGAAGTTGG + Intergenic
1189039056 X:37523006-37523028 GCAGACATTTATTTTGAAGTCGG - Intronic
1189548140 X:42064839-42064861 AGACACACTGATTTTAAAATGGG - Intergenic
1189888204 X:45571416-45571438 CAAAAGATTAATTTTAAAATGGG - Intergenic
1192865126 X:75122845-75122867 ACACACCCCAATTTTAAAATGGG - Intronic
1193158723 X:78203716-78203738 TGACACATTAATATTAAAAATGG - Intergenic
1193415902 X:81223679-81223701 TAAAACACTAATTTTAAAATTGG - Intronic
1193547649 X:82849578-82849600 ACACAAGTTAATTTTTAAATTGG + Intergenic
1193878211 X:86889200-86889222 GTTCACATTAATTGTATAATAGG + Intergenic
1194097849 X:89665735-89665757 GCACACACTAATATTAACAGAGG + Intergenic
1194175770 X:90646796-90646818 GCACATATTAGGTTCAAAATGGG + Intergenic
1194394608 X:93366744-93366766 GAAAAAATTAATTTTAAAATGGG - Intergenic
1195484512 X:105388453-105388475 GCAAACATTATTTTAAAACTTGG + Intronic
1195494711 X:105517306-105517328 GCATACATAAATTTGAAATTAGG - Intronic
1195526232 X:105893183-105893205 GAAGATATTAGTTTTAAAATAGG + Intronic
1196499898 X:116367748-116367770 GCCTACACTAATTTTCAAATTGG + Intergenic
1197231043 X:124003781-124003803 TAACACCTTAATTTGAAAATTGG - Intronic
1197609222 X:128620338-128620360 GTACAAATTACTTGTAAAATGGG - Intergenic
1198978451 X:142364571-142364593 GCACAAAATAATGTGAAAATTGG + Intergenic
1199183383 X:144885289-144885311 GGCCAAAATAATTTTAAAATGGG + Intergenic
1199865940 X:151850149-151850171 AAATACATTAATTTTAAAAATGG + Intergenic
1200291464 X:154879139-154879161 TTACACATGAATTTTAAGATTGG - Intronic
1200313828 X:155109307-155109329 CCCCATATAAATTTTAAAATCGG + Intronic
1200381085 X:155838025-155838047 GCACACATAGATATAAAAATGGG + Intergenic
1200515555 Y:4140557-4140579 ACACACACTATTTTTCAAATTGG + Intergenic
1200522409 Y:4227754-4227776 GCACATATTAGGTTCAAAATGGG + Intergenic
1201233026 Y:11883954-11883976 GCAAAGATTAATTTGGAAATGGG - Intergenic