ID: 1081699945

View in Genome Browser
Species Human (GRCh38)
Location 11:45146699-45146721
Sequence CAGCCTCGGCGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 453}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081699945_1081699953 2 Left 1081699945 11:45146699-45146721 CCGCCGCCGCCGCGCCGAGGCTG 0: 1
1: 0
2: 3
3: 40
4: 453
Right 1081699953 11:45146724-45146746 GCTGAAACTTTGCCTCGCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1081699945_1081699951 0 Left 1081699945 11:45146699-45146721 CCGCCGCCGCCGCGCCGAGGCTG 0: 1
1: 0
2: 3
3: 40
4: 453
Right 1081699951 11:45146722-45146744 GCGCTGAAACTTTGCCTCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 65
1081699945_1081699956 23 Left 1081699945 11:45146699-45146721 CCGCCGCCGCCGCGCCGAGGCTG 0: 1
1: 0
2: 3
3: 40
4: 453
Right 1081699956 11:45146745-45146767 GGACCAGCGCGCCCGCAGCGCGG 0: 1
1: 0
2: 2
3: 6
4: 112
1081699945_1081699952 1 Left 1081699945 11:45146699-45146721 CCGCCGCCGCCGCGCCGAGGCTG 0: 1
1: 0
2: 3
3: 40
4: 453
Right 1081699952 11:45146723-45146745 CGCTGAAACTTTGCCTCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081699945 Original CRISPR CAGCCTCGGCGCGGCGGCGG CGG (reversed) Intronic
900091143 1:921222-921244 CAGCCTCAGCCCAGCGGCGGAGG + Intergenic
900237611 1:1600158-1600180 CGGACCCGGCGCGGCGGCGGAGG + Intergenic
900409121 1:2504919-2504941 CAGCCTGGGCCCGGCTGGGGAGG + Exonic
900483702 1:2911398-2911420 CAGCAGCGCCGCGGCGGCCGCGG - Intergenic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901506646 1:9689608-9689630 CAGCCTCCGGGCAGCGGCGCGGG - Intronic
901526015 1:9823867-9823889 CAGCGTCACGGCGGCGGCGGCGG - Exonic
902323648 1:15684499-15684521 AAGCGGCGGCGGGGCGGCGGCGG + Exonic
902323649 1:15684502-15684524 CGGCGGCGGGGCGGCGGCGGCGG + Exonic
903072200 1:20732054-20732076 CAGGCGCGGGGCTGCGGCGGCGG - Intronic
903115534 1:21176308-21176330 CGGCACCGGAGCGGCGGCGGCGG - Exonic
903485678 1:23688225-23688247 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
903501013 1:23800277-23800299 CAGGCGCGGGGCGGGGGCGGGGG - Intronic
903750176 1:25616685-25616707 CGGCTGCGGCGCGGCGGCGGCGG + Intergenic
903961948 1:27063483-27063505 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
904190133 1:28737061-28737083 TCTCCTCAGCGCGGCGGCGGCGG - Exonic
904642010 1:31938134-31938156 CCGGCCCGGCCCGGCGGCGGCGG + Exonic
904720059 1:32500821-32500843 GAGCCTCCTGGCGGCGGCGGCGG + Intronic
904744467 1:32702626-32702648 GAGCCCCGGCGCGGCGGGGACGG - Exonic
904761156 1:32805186-32805208 CAGCCTCGGCTCGGCATCAGAGG + Intronic
904831808 1:33310261-33310283 CAGCCTCGGCTCGGCATCAGAGG + Intronic
905584348 1:39105339-39105361 CCGCCCCGGCGCGGCTGCAGCGG - Intronic
905862538 1:41361196-41361218 CCTGCTCGGCGCGGAGGCGGGGG - Intergenic
906637012 1:47416485-47416507 CCGGCCCGGGGCGGCGGCGGCGG + Exonic
906662545 1:47593274-47593296 CAGCCCCGGGCTGGCGGCGGCGG - Intergenic
909440704 1:75692480-75692502 CATCCTCGGGCCGGCTGCGGTGG - Intergenic
910657581 1:89633617-89633639 CAGACTGGGCGCGGGGGTGGGGG + Intronic
911527541 1:99004752-99004774 CACCGGGGGCGCGGCGGCGGAGG + Exonic
912318978 1:108692667-108692689 CAGCAGCAGTGCGGCGGCGGCGG + Exonic
914386274 1:147172647-147172669 CACCATCGAGGCGGCGGCGGCGG - Intergenic
914725189 1:150321481-150321503 CAGCGGCGTGGCGGCGGCGGTGG + Exonic
915325320 1:155078908-155078930 CAGTCGGGGGGCGGCGGCGGCGG + Exonic
916049897 1:161029005-161029027 CAGCCTCGGCTCGGCATCAGAGG - Intronic
916563424 1:165952869-165952891 CAGGCCGGGCGCGGTGGCGGTGG - Intergenic
916961424 1:169893636-169893658 CGAGCTCGGCGCGGCGCCGGCGG - Intronic
917433897 1:174999876-174999898 CAGACTCGGCGGGGCGGGGAGGG + Exonic
918172321 1:182010264-182010286 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
921192626 1:212724283-212724305 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
922766395 1:228158681-228158703 GGGCCGCGGCGCGGGGGCGGGGG - Exonic
923134402 1:231105396-231105418 CAGCATCGGGGCAGTGGCGGGGG + Intergenic
923716527 1:236429152-236429174 CAGCCTCGGCTCGGCATCAGAGG + Intronic
1063365738 10:5489124-5489146 CAGCCTAGGCACTGCGGCCGTGG + Intergenic
1063392831 10:5661321-5661343 CAGGCTCGGCGGGGCGGGGTTGG - Intronic
1063420519 10:5909225-5909247 CAGCCTCGGGGAGGAGGGGGTGG - Exonic
1063995088 10:11611518-11611540 GCGGCGCGGCGCGGCGGCGGCGG + Intronic
1064208968 10:13347771-13347793 CCGGCCCCGCGCGGCGGCGGCGG + Intronic
1064230919 10:13528878-13528900 GGGCCGGGGCGCGGCGGCGGCGG + Intronic
1065101594 10:22336535-22336557 CTGCCGCGGCGCGGCCGCGCCGG - Intergenic
1065188872 10:23192967-23192989 CTGCGGCGGCGCGGCGCCGGCGG + Exonic
1066325213 10:34352383-34352405 CAGCCTCGGCTCGGCATCAGAGG - Intronic
1066963776 10:42243008-42243030 AAGCCTCGGCGGGGGGGAGGGGG - Intergenic
1067336990 10:45374227-45374249 GAGCCTCGGCGCGGCGGTCCAGG - Exonic
1069019131 10:63465950-63465972 TGGCCGCGGCGCGGTGGCGGCGG - Intergenic
1069386171 10:67884919-67884941 CTGCCCGGGTGCGGCGGCGGCGG + Exonic
1069769353 10:70887924-70887946 CACCCCCGGGGCGGGGGCGGGGG - Intronic
1070367596 10:75751273-75751295 CAGCCTCGGCTCGGCATCAGAGG + Intronic
1070767964 10:79067338-79067360 CAGCCCCGGCCGGGCTGCGGGGG - Intergenic
1070877385 10:79826375-79826397 AAGCGGCGGGGCGGCGGCGGCGG + Intergenic
1071695381 10:87863912-87863934 CGGCTGAGGCGCGGCGGCGGCGG + Exonic
1072409073 10:95183880-95183902 TCGCCCCGGGGCGGCGGCGGCGG - Intergenic
1072420981 10:95290633-95290655 CAGCCTCCGCGAAGGGGCGGCGG + Intronic
1072562297 10:96587116-96587138 CTCCCTCGGCCCGGCGGCGGTGG - Intronic
1073099529 10:100999565-100999587 TCGGCTCGACGCGGCGGCGGCGG - Exonic
1073105704 10:101031147-101031169 CAGCCTCCGCGCAGCGTGGGTGG - Intronic
1074503122 10:114043996-114044018 CAGCCGCGGCGCGGGGCCGGAGG - Intergenic
1074503478 10:114045482-114045504 CTGCAACGGCGGGGCGGCGGCGG + Exonic
1075095354 10:119467622-119467644 CAGGCTGGGCGCGGTGGCTGAGG - Intergenic
1075802147 10:125160357-125160379 CACCCTGGAGGCGGCGGCGGCGG + Intronic
1076373910 10:129971355-129971377 GTGCGTCGGCGCGGGGGCGGGGG + Intergenic
1076554206 10:131311514-131311536 CAGACCCAGGGCGGCGGCGGCGG + Exonic
1076749888 10:132537417-132537439 CAGCCGCGGCGCGGGGGGCGGGG + Intergenic
1077232086 11:1462287-1462309 CAGCCCGGGTGCGGCGGCCGTGG + Intronic
1078233214 11:9461130-9461152 CGCCCTCAGCGCGGCGGCGCGGG + Intronic
1078729490 11:13962737-13962759 CCGCCTCGGCTTGGCGGCCGCGG - Exonic
1079128502 11:17734838-17734860 CAGCAGCGTCGCGGCGGCGGCGG + Exonic
1079459768 11:20669502-20669524 CACCGCTGGCGCGGCGGCGGCGG - Intergenic
1080012496 11:27472560-27472582 CCGGCCCGGCGCAGCGGCGGGGG + Exonic
1080015911 11:27506686-27506708 CAGCCGAGGCTCGGCGGAGGTGG - Intronic
1080538236 11:33243124-33243146 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
1081699945 11:45146699-45146721 CAGCCTCGGCGCGGCGGCGGCGG - Intronic
1081872955 11:46391586-46391608 CCGCGGCGGCGCGGGGGCGGGGG - Intergenic
1081981703 11:47270491-47270513 CAGGTTCGGGGCGGGGGCGGGGG + Intronic
1082023355 11:47553046-47553068 CAGCAGCGAGGCGGCGGCGGCGG - Intronic
1082028690 11:47589842-47589864 GAGGCCCGGCGGGGCGGCGGGGG + Exonic
1082166610 11:48956484-48956506 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1083778306 11:64905511-64905533 CAGCTTCGGCCCGGCGAGGGTGG + Intronic
1083797741 11:65027440-65027462 CAGGCCTGGCGAGGCGGCGGCGG + Exonic
1084068469 11:66718912-66718934 CAGGCCCTGCGGGGCGGCGGAGG + Intronic
1085205831 11:74731368-74731390 CGGCGGCGGCGCGGCGGCCGCGG + Intronic
1085561269 11:77474206-77474228 CCTCCCCGGCGCGGCGGCGGCGG + Intronic
1087487143 11:98770713-98770735 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1088810202 11:113387146-113387168 CAGCCTCGGGGTGGCCACGGGGG - Intergenic
1089242974 11:117097987-117098009 CAGCCGCGGCGGGGCGGGCGCGG - Intronic
1089396299 11:118138095-118138117 CAGCCTGGGCGCTGCTGTGGAGG - Intronic
1089397267 11:118144613-118144635 GAGCATTGGCGCGGCTGCGGTGG - Intronic
1089499906 11:118925777-118925799 CTGGCTCCGGGCGGCGGCGGTGG + Intronic
1089584556 11:119502255-119502277 CAGCCTCGGGGCTGCTGCTGCGG + Intergenic
1089729465 11:120511530-120511552 GAGCCCAGGCGCGGGGGCGGCGG - Intergenic
1090002941 11:122977745-122977767 CAGCCGAGCCTCGGCGGCGGTGG + Exonic
1090238286 11:125165159-125165181 CAAGCGCGGCGAGGCGGCGGCGG - Intronic
1091225744 11:133955905-133955927 CTGGCTGGGGGCGGCGGCGGGGG - Intronic
1091383556 12:78049-78071 CTTCCTCAGCGGGGCGGCGGGGG - Intronic
1091616229 12:2053049-2053071 CGGGCCCGGAGCGGCGGCGGCGG + Intronic
1091823643 12:3493538-3493560 CAGACCCCGCGCGGCAGCGGGGG - Intronic
1094470279 12:30796236-30796258 CGGCCGCGGGGCGGCGGGGGCGG - Intergenic
1096336947 12:50764061-50764083 AAGCCTGGGGGCGGGGGCGGGGG - Intronic
1097107695 12:56635029-56635051 CAGCCCTGGGCCGGCGGCGGCGG + Intronic
1098550376 12:71755147-71755169 CGGCGGCGGCGGGGCGGCGGCGG + Exonic
1098550377 12:71755150-71755172 CGGCGGCGGGGCGGCGGCGGCGG + Exonic
1098774039 12:74588891-74588913 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1100606748 12:96158142-96158164 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
1101144801 12:101830878-101830900 CGCCCTCGGCGCGGCGGAGGCGG + Exonic
1101606007 12:106248042-106248064 CGGGGTCGGCGCCGCGGCGGCGG - Intronic
1102136888 12:110583034-110583056 CCTCCTCGGGGGGGCGGCGGCGG - Exonic
1102453265 12:113056803-113056825 AAAGCTCGGCGCGGCGGCCGAGG + Intronic
1102520681 12:113476062-113476084 CCGGGTCTGCGCGGCGGCGGCGG + Intergenic
1103362436 12:120361994-120362016 CAGGCCCGGCTCGGCTGCGGCGG - Intronic
1103364244 12:120370120-120370142 CAGCCTCGGTGTGGTGGGGGTGG - Intergenic
1103474807 12:121210431-121210453 GGGCCCCGGCGCGGCGGCTGGGG - Intronic
1105472068 13:20703732-20703754 CCGGCTCGGGGCGGCGGCGGCGG + Intronic
1106512388 13:30422369-30422391 CTCCCTGGCCGCGGCGGCGGTGG + Intergenic
1106517092 13:30465198-30465220 CGGCCCGGTCGCGGCGGCGGCGG - Intronic
1106517095 13:30465204-30465226 CGGCCTCGGCCCGGTCGCGGCGG - Intronic
1106517161 13:30465389-30465411 CCGGCGCGGCTCGGCGGCGGCGG - Intronic
1106799377 13:33241578-33241600 CAGCCTCGGCTCGGCATCAGAGG - Intronic
1107604027 13:42040809-42040831 GAGCCCCGGCGCAGCGGCGGCGG + Intronic
1107851497 13:44576825-44576847 CGGCCGGGGCGCGGCGGCGGCGG + Intronic
1108013828 13:46052447-46052469 GCTCCTCGGAGCGGCGGCGGCGG - Intronic
1110453974 13:75669373-75669395 CAGATTTGGCGGGGCGGCGGGGG - Intronic
1111388458 13:87561131-87561153 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
1111951282 13:94711416-94711438 CTTCCACGGCGCGGCGGCGGCGG - Exonic
1111951658 13:94713043-94713065 CAGCCTCCACGCGGCGCCGCAGG + Intergenic
1112752477 13:102596942-102596964 CGGCCTCGGGCCGGAGGCGGGGG - Intergenic
1114578602 14:23736367-23736389 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
1115028233 14:28766822-28766844 CAGCCTCGCCGCGGCCGCTCCGG + Intergenic
1115494052 14:33985046-33985068 CAGCCTCGGCTCGGCATCAGAGG + Intronic
1115761314 14:36581065-36581087 CAGCCGTGCGGCGGCGGCGGCGG - Exonic
1115851236 14:37591951-37591973 CAGCCGGGGGCCGGCGGCGGGGG - Exonic
1116959783 14:50957190-50957212 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1117010780 14:51468249-51468271 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1117920790 14:60723760-60723782 CGGGGTCTGCGCGGCGGCGGCGG + Exonic
1118809038 14:69260520-69260542 CAGACCCTGCGCGGCGGCCGAGG + Intronic
1118883822 14:69850448-69850470 CAGCCATGGCGGGGCGGCAGGGG - Intergenic
1120200556 14:81533813-81533835 GAGCAGCGGCGAGGCGGCGGTGG - Exonic
1120892716 14:89505312-89505334 CAGCCTCGGCTCGGCATCAGAGG - Intronic
1122221235 14:100240060-100240082 CGGCGGGGGCGCGGCGGCGGCGG + Intronic
1122445011 14:101761773-101761795 CAGTCCCCGGGCGGCGGCGGCGG + Intergenic
1122942042 14:104985848-104985870 CCGCCTCGGCGGGGCCGCGCGGG - Exonic
1123037992 14:105479078-105479100 GAGCCCCGGGGCGGGGGCGGGGG - Intronic
1123040216 14:105487334-105487356 CAGCCTCGTCGCCCCGTCGGCGG - Intronic
1202853658 14_GL000225v1_random:37019-37041 CAGCCTGGCCGCGCCGGCAGAGG + Intergenic
1124607734 15:31184005-31184027 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
1125508912 15:40282589-40282611 CTGCCCGGGCGCGGCGGCCGGGG - Intronic
1126142683 15:45450798-45450820 CAGCCTCAGCGAGGCGGCCCTGG + Intergenic
1126816682 15:52460604-52460626 CAGCCTCGGCTCGGCATCAGAGG + Intronic
1127144082 15:56007187-56007209 CAGGATCCGGGCGGCGGCGGCGG + Intergenic
1128737442 15:70061205-70061227 CAGCCTCACCGTGGAGGCGGGGG - Intronic
1129189138 15:73927413-73927435 CGGCGTGGGCGCGGGGGCGGCGG + Exonic
1129273883 15:74433254-74433276 CTGCCGAAGCGCGGCGGCGGCGG + Intronic
1129438093 15:75558566-75558588 CAGCTTCGGCTCGGCGTCAGAGG - Intronic
1129752821 15:78077685-78077707 CGGCCGCGGCGCGGAGGCGCAGG - Intronic
1129799792 15:78405529-78405551 CAGCCCCGGCGGGGCTGTGGTGG - Intergenic
1131144429 15:90002013-90002035 AAGCGTCGCGGCGGCGGCGGCGG + Intronic
1132255573 15:100373479-100373501 CCGGCCAGGCGCGGCGGCGGCGG + Intergenic
1132765925 16:1534145-1534167 CATCCTCGGGGCGGCGCGGGCGG - Exonic
1132809244 16:1789763-1789785 CAGCCAGGGCGCGGCTGAGGTGG - Intronic
1132816030 16:1826982-1827004 GGGCCTGGGAGCGGCGGCGGCGG + Exonic
1132915278 16:2340574-2340596 GAGCCTGGGCGCCGGGGCGGCGG + Exonic
1133021631 16:2969459-2969481 CCGCCCCGGCGCGGGGGCGACGG + Exonic
1134482311 16:14630285-14630307 CAGCGCCTGCGCGGCGGCGGGGG + Intronic
1134587904 16:15428036-15428058 CAGCCAGGGCTCGGGGGCGGTGG + Intronic
1135565853 16:23510417-23510439 CAGCCCCGACGCTGCGGCCGCGG + Exonic
1135821885 16:25692387-25692409 CCGGCTCGCGGCGGCGGCGGCGG - Exonic
1136165017 16:28447997-28448019 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
1136197948 16:28666983-28667005 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1136214295 16:28781160-28781182 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1136259015 16:29061005-29061027 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1137300434 16:47143675-47143697 ACGGCTCGGCGCGGCGGCGACGG + Exonic
1137439205 16:48483804-48483826 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1138105318 16:54284690-54284712 CAGTCTGTGAGCGGCGGCGGCGG + Exonic
1138178592 16:54928370-54928392 AAGCCACGGGGCGGGGGCGGGGG + Intergenic
1138360749 16:56425441-56425463 CCGGCCCGGCGCGGCGGCGGCGG - Exonic
1139475081 16:67199070-67199092 CCGCCTCGGCGGGGCGGGGCAGG + Intergenic
1140223128 16:73058229-73058251 CGGCCCGGGCTCGGCGGCGGCGG + Intronic
1141608644 16:85169438-85169460 CAAGTTGGGCGCGGCGGCGGCGG + Intergenic
1141831156 16:86510594-86510616 CAGCCACCGCACGGCGGCGGCGG + Exonic
1141832243 16:86516234-86516256 CAGTCTCGGCGCTGCAGCAGCGG - Intergenic
1141972391 16:87492566-87492588 CGGCCGGTGCGCGGCGGCGGCGG + Intergenic
1142271795 16:89093790-89093812 CCGCCACGGCGCCGCGCCGGGGG + Exonic
1142764327 17:2057102-2057124 CACCTGCGGGGCGGCGGCGGCGG + Exonic
1142863327 17:2776549-2776571 CAGCCGCGGAGAGGGGGCGGAGG - Intergenic
1143134563 17:4704274-4704296 CAGCCTGGGCGCCGAGGCAGCGG + Exonic
1143527264 17:7479698-7479720 CGGCCTCCTCTCGGCGGCGGCGG - Intronic
1144339745 17:14301679-14301701 CAGCCCCGGCGCGGCGGCGCAGG - Exonic
1144340818 17:14309330-14309352 CAGCCTAGGGGCGGGGGAGGCGG - Intronic
1144586851 17:16492256-16492278 GAGCTCCGGCGCGGAGGCGGGGG - Intergenic
1144656955 17:17042829-17042851 CATGGTCGGCGCGGCGGCGACGG - Exonic
1144742591 17:17592178-17592200 GAGCCTGGGCGCCGCGGGGGCGG - Intergenic
1144816621 17:18039647-18039669 CGGCTCCCGCGCGGCGGCGGCGG + Exonic
1144847080 17:18225634-18225656 CATCCTGCGGGCGGCGGCGGCGG + Exonic
1145256144 17:21323529-21323551 CAGCCTGGGAGGGGCGTCGGAGG + Intergenic
1145320469 17:21764421-21764443 CAGCCTGGGAGGGGCGTCGGAGG - Intergenic
1145327705 17:21844355-21844377 CGCCCTCAGAGCGGCGGCGGCGG - Intergenic
1146183106 17:30709538-30709560 CGGCCCCCTCGCGGCGGCGGAGG - Intergenic
1146260587 17:31417640-31417662 CAGCCTAGGTGGGGCTGCGGTGG + Intronic
1147200644 17:38799422-38799444 CATGCCCGGGGCGGCGGCGGCGG + Exonic
1147307406 17:39573640-39573662 CCGGCGCGGCCCGGCGGCGGCGG - Intergenic
1147792495 17:43022182-43022204 CAGTGGCGGCGAGGCGGCGGCGG + Exonic
1148021650 17:44557590-44557612 CAGCCGCAGCGAGGAGGCGGCGG + Exonic
1148911246 17:50944319-50944341 CAGGCTTGGCGCGGAGGCGCAGG + Intergenic
1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG + Intronic
1150168443 17:62966494-62966516 TCGGCTCGGCTCGGCGGCGGCGG - Intergenic
1150273667 17:63882462-63882484 GAGCCTTGGGGCGGGGGCGGGGG + Intergenic
1151370741 17:73644881-73644903 CAGCCGCGGGGCGGCGGGGGAGG + Intergenic
1151605304 17:75131704-75131726 CAGCTCCGGCCCGGCGGCGATGG - Exonic
1151703043 17:75753523-75753545 CAGCCTCGGCACAGCTGGGGAGG - Intronic
1152345334 17:79747676-79747698 CAGCCCCCGCGCCGCTGCGGTGG - Intergenic
1152631051 17:81410825-81410847 CAGTCTCGGGGCGGGGGTGGGGG + Intronic
1152729020 17:81960936-81960958 CGGCCTTGAGGCGGCGGCGGCGG + Exonic
1152744274 17:82031863-82031885 CAGCCGGGGCGGGGCGGGGGTGG + Intronic
1155508007 18:26549880-26549902 GAGCCTGGGCGCGCCGGGGGCGG - Intronic
1157857876 18:51118039-51118061 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1160499850 18:79396208-79396230 TGGCATCCGCGCGGCGGCGGCGG - Exonic
1160766586 19:811277-811299 CAGCTGGGGCGCGGCGGCCGCGG + Exonic
1161022137 19:2015533-2015555 CGGCCCAGGGGCGGCGGCGGCGG + Exonic
1161044588 19:2128465-2128487 CAGTGTCGGAGCGGCGGGGGCGG - Intronic
1161044626 19:2128583-2128605 CAGTGTCGGAGCGGCGGGGGCGG - Intronic
1161044640 19:2128623-2128645 CAGTGTCGGAGCGGCGGGGGCGG - Intronic
1161044666 19:2128702-2128724 CAGTGTCGGAGCGGCGGGGGCGG - Intronic
1161044692 19:2128781-2128803 CAGTGTCGGAGCGGCGGGGGCGG - Intronic
1161044718 19:2128860-2128882 CAGTGTCGGAGCGGCGGGGGCGG - Intronic
1161044746 19:2128940-2128962 CAGTGTCGGAGCGGCGGGGGCGG - Intronic
1161044760 19:2128980-2129002 CAGTGTCGGAGCGGCGGGGGCGG - Intronic
1161044774 19:2129020-2129042 CAGTGTCGGAGCGGCGGGGGCGG - Intronic
1161215620 19:3094038-3094060 CGGCCCAGGCGCGGTGGCGGAGG - Intergenic
1161215693 19:3094247-3094269 CGGCCTGGGCGGGGCGTCGGCGG - Intergenic
1161382153 19:3971092-3971114 CAGGCGCGTCGCGGCGGCAGGGG - Intronic
1161685611 19:5701369-5701391 CAGCCTCGGCTCGGCATCAGAGG - Intronic
1162033199 19:7926041-7926063 CGGCCTCTCCCCGGCGGCGGCGG + Exonic
1162602285 19:11677834-11677856 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1162954469 19:14090542-14090564 GCGCCTCGGCGGAGCGGCGGCGG + Exonic
1162975688 19:14206230-14206252 CGGCCCCCTCGCGGCGGCGGAGG + Intergenic
1163123497 19:15232042-15232064 CGGCCCCGGCGCGGCTGCTGCGG - Exonic
1163163527 19:15479915-15479937 CAGCATCGGTGCGGGGGCTGAGG + Intronic
1163513077 19:17747714-17747736 CAGCCGCGCCGCAGCCGCGGAGG + Exonic
1163613996 19:18315959-18315981 CAGCCTCAGCACAGGGGCGGTGG - Intronic
1164054881 19:21614329-21614351 CAGCCTCGGCTGGGCGTCAGAGG - Intergenic
1164179734 19:22807760-22807782 CAGGCTCCGTGCGGCGGCGCTGG - Intergenic
1164658544 19:29942330-29942352 CCGCTGCGGGGCGGCGGCGGCGG + Exonic
1164834537 19:31349248-31349270 CAGCCCGGCAGCGGCGGCGGCGG - Exonic
1165204521 19:34172457-34172479 AAGCCGCGGCGCGGCGGCGGCGG - Intergenic
1165420066 19:35718085-35718107 CGGCCGCGGGGCGCCGGCGGGGG + Exonic
1166808149 19:45499126-45499148 AGCCCTCGACGCGGCGGCGGCGG - Exonic
1167134644 19:47609449-47609471 TAGGATCGGGGCGGCGGCGGTGG - Intronic
1168718987 19:58544642-58544664 CGGCCTCGCGGCGGCGGCGGCGG + Exonic
925318271 2:2941337-2941359 CAGCCTCGTCATGGCGGCAGCGG + Intergenic
926130963 2:10302903-10302925 CAGGCGGGCCGCGGCGGCGGCGG + Intronic
927881455 2:26692704-26692726 CAGCTCCGCGGCGGCGGCGGCGG + Intronic
928303575 2:30147478-30147500 CAGCCGCGGCGCGGCGCGGCGGG - Intronic
929133504 2:38602166-38602188 GGGTCGCGGCGCGGCGGCGGCGG - Intronic
929188711 2:39120745-39120767 CAGCCCCGGCGGGCGGGCGGCGG - Intronic
932495199 2:72142748-72142770 CAGCCTGGGGGCGGCGGGAGAGG - Intronic
933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG + Intergenic
933908057 2:86914272-86914294 TGGCCTCGGCCGGGCGGCGGCGG + Intronic
934011587 2:87825482-87825504 CGGCCTCGGCCGGGCGGCGGCGG - Intronic
934261195 2:91478110-91478132 CGGCACCGGGGCGGCGGCGGCGG - Intergenic
934566972 2:95346589-95346611 CGGCGGCGGCGCGGCGGCGGGGG - Intronic
934882443 2:97995705-97995727 CCTTCTCGGCGAGGCGGCGGCGG + Exonic
936126696 2:109794576-109794598 CGGCCGGGGGGCGGCGGCGGCGG + Intronic
936158362 2:110064600-110064622 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
936186299 2:110306726-110306748 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
936222042 2:110611138-110611160 AACCCTAGGAGCGGCGGCGGCGG - Intergenic
936345466 2:111672114-111672136 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
937045133 2:118847104-118847126 GGCCCTCGGCGCGGCGGCGGCGG - Exonic
937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG + Intronic
938018393 2:127885987-127886009 AAGCGGCGGGGCGGCGGCGGCGG + Intergenic
938038144 2:128053526-128053548 CAGAATTGGGGCGGCGGCGGCGG - Intergenic
938043531 2:128096128-128096150 CAGGCTTGGAGCGGCTGCGGAGG + Intronic
938397730 2:130963498-130963520 CAGGCTCGTCGCAGCCGCGGTGG - Intronic
938737544 2:134200160-134200182 CAGCCTTGGCGGGGCAGGGGGGG - Intronic
939432653 2:142130775-142130797 CACCTTCGGCCCGGCGGCGGCGG + Exonic
941095603 2:161237621-161237643 CTGCCTCGCCTCGGCGGGGGTGG - Intergenic
941978925 2:171434128-171434150 CAGCCTCCGCGGGCCGGAGGAGG + Intronic
942453307 2:176121974-176121996 GAGCCGGGGCGCGGCGGTGGAGG - Intergenic
944570694 2:201041994-201042016 CAGCCTCGGCTCGGCATCAGAGG - Intronic
945864991 2:215164231-215164253 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
946447505 2:219751957-219751979 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
947418568 2:229921952-229921974 CCCCAGCGGCGCGGCGGCGGCGG + Exonic
947558773 2:231126286-231126308 CAGCTACTGGGCGGCGGCGGAGG + Intronic
947741727 2:232487830-232487852 CGGGCTCGGCGCGGCGGCAGAGG - Intergenic
948645311 2:239400662-239400684 CAGCCCCGGCCCGGCGCCCGCGG - Exonic
1168883256 20:1225647-1225669 GGGACTGGGCGCGGCGGCGGCGG - Intergenic
1169065598 20:2692879-2692901 CGGCCGCGGCGGGGCGGCGCGGG + Exonic
1169093167 20:2873623-2873645 GAGCCCCGCGGCGGCGGCGGCGG - Intronic
1169109017 20:3020032-3020054 CAGCTTCGGCTCGGCATCGGAGG + Intronic
1169195889 20:3681853-3681875 CAGGCTAGGCGCGGTGGTGGTGG - Intronic
1169214730 20:3786515-3786537 CCGCCCCGGGGCGGCGGCGGCGG - Exonic
1169244541 20:4015387-4015409 CAGCCCGGGGGCGGCGGCCGCGG + Intronic
1170150419 20:13221468-13221490 CTGCCTGGCGGCGGCGGCGGCGG - Intergenic
1170150446 20:13221543-13221565 CCGCCGTGGTGCGGCGGCGGCGG + Intergenic
1172295932 20:33811321-33811343 CAGCTGCGGGGCGGAGGCGGAGG + Exonic
1172771343 20:37384320-37384342 CAGCTTGGGCTCGGCGGCCGCGG - Exonic
1174468011 20:50731918-50731940 CAGGCTCGGAGCGCCGGGGGAGG + Intronic
1175429427 20:58891356-58891378 TTGGCTCGGGGCGGCGGCGGGGG + Intronic
1175715445 20:61252209-61252231 GGGCCTCGGCGGGGCGGCCGCGG + Intergenic
1175847006 20:62064802-62064824 CGGGCCCGGCGCGGCGGCTGCGG - Exonic
1176550006 21:8216980-8217002 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1176568932 21:8400014-8400036 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1176576846 21:8444249-8444271 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1178417083 21:32412719-32412741 CAGCCTGGGCAGGGAGGCGGCGG + Exonic
1179437177 21:41369846-41369868 CAGCCACGGCGGGGCGGGAGCGG - Intronic
1179674989 21:42974970-42974992 CAGGCCCAGCGCGGCGGCGGCGG - Intronic
1180156744 21:45981782-45981804 CGGTCTCTGGGCGGCGGCGGCGG + Exonic
1180264214 21:46699281-46699303 GAGGCGCGGCGCGCCGGCGGAGG - Intergenic
1180713467 22:17855874-17855896 CAGCCTGGGCTCGGCAGCGTGGG - Intronic
1180908339 22:19431487-19431509 TCGCCTCAGCCCGGCGGCGGCGG - Exonic
1180914891 22:19479168-19479190 CCGGCTTGGCGCGGCGGCAGCGG - Exonic
1181478028 22:23180582-23180604 CGGCGGCGGCACGGCGGCGGCGG + Exonic
1181586870 22:23857464-23857486 CAGCCTCAGTGCTGCGGCAGAGG + Exonic
1182236956 22:28883658-28883680 CAGCCCCATCACGGCGGCGGCGG - Exonic
1182475526 22:30574599-30574621 CGGGCGCGGCGCGGCAGCGGCGG - Intergenic
1183211700 22:36455260-36455282 CAGGCTCGGCGCGGGAGGGGCGG + Intergenic
1183981744 22:41544528-41544550 CCGCCTCGGCGGGGTGGGGGTGG - Intronic
1184145338 22:42607149-42607171 CAGCCTCGGCTCGGCATCAGAGG - Intronic
1184412236 22:44331894-44331916 GAGCATGAGCGCGGCGGCGGCGG - Intergenic
1184759145 22:46535190-46535212 CAGCTTCGGGGTGGAGGCGGTGG - Exonic
1185037932 22:48489460-48489482 GGGCCCGGGCGCGGCGGCGGCGG + Exonic
1185055262 22:48575860-48575882 CTGGCCCGCCGCGGCGGCGGTGG + Intronic
1185278485 22:49960108-49960130 CAGCCTCGCAGCCCCGGCGGGGG - Intergenic
1203254896 22_KI270733v1_random:133306-133328 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1203262952 22_KI270733v1_random:178385-178407 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
950729766 3:14947541-14947563 CAGCCTCGCCGCCGCGGCGGGGG - Intergenic
950729887 3:14947929-14947951 CGGGCTCGGGCCGGCGGCGGAGG + Intronic
951898382 3:27632892-27632914 CAGCGGCGGCGCGGAGGCAGCGG - Intergenic
951898386 3:27632909-27632931 CAGCGGCGGCGCGGAGGCAGCGG - Intergenic
951898390 3:27632926-27632948 CAGCGGCGGCGCGGAGGCAGCGG - Intergenic
951898394 3:27632943-27632965 CAGCGGCGGCGCGGAGGCAGCGG - Intergenic
952152404 3:30606995-30607017 CGGGCTCGGCGGGGCGCCGGGGG + Intronic
952354296 3:32570484-32570506 CGGCCTCGGCGCGCCGGGGATGG + Intronic
953627239 3:44581024-44581046 CATGGTCGGCGCGGCGGCGGCGG + Intronic
954063582 3:48088773-48088795 CAGCTCCGTCTCGGCGGCGGCGG - Exonic
954202102 3:49029500-49029522 CCGCCTCGCTGCGGCGGGGGCGG + Intergenic
954540637 3:51391274-51391296 AGGACTCGGCGCGGCGGTGGCGG - Exonic
954567223 3:51608784-51608806 CAGCCTCGGCTCGGCATCAGAGG + Intronic
955387635 3:58492154-58492176 CACTCACTGCGCGGCGGCGGCGG - Intronic
960577343 3:119242003-119242025 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
960582743 3:119294678-119294700 CGGCCTCGGCACGGCGGCCCCGG + Exonic
960586118 3:119322860-119322882 CAAACTCGGCCCGGCCGCGGGGG + Intronic
961012908 3:123448119-123448141 CGGCGGCGGCTCGGCGGCGGCGG - Exonic
963253040 3:143119842-143119864 CCGCTTTCGCGCGGCGGCGGCGG + Exonic
964118562 3:153160722-153160744 CAGGCTGAGCTCGGCGGCGGCGG - Intergenic
965757415 3:172040309-172040331 CCGCCTCTCCGCGCCGGCGGGGG + Intronic
966967086 3:185004438-185004460 CAGCCTCGGCTCGGCCTCAGAGG + Intronic
967166480 3:186784054-186784076 CGGCCACGGCGCGGAGGCGACGG + Intronic
967685274 3:192409901-192409923 AGGCGGCGGCGCGGCGGCGGGGG - Intronic
968225582 3:196970026-196970048 CAGCGTCGGGCCGGCGGCGCGGG - Intergenic
968372752 4:11005-11027 CCGCCGCGGCGCCGTGGCGGTGG + Intergenic
968548792 4:1212201-1212223 CAGCCTCGGCGCCTGGGCAGAGG - Exonic
968636664 4:1684428-1684450 CAGCCGCGCCGCGCCGACGGAGG + Intergenic
968674707 4:1871323-1871345 CGGCTTCTGCGAGGCGGCGGCGG + Intergenic
969208882 4:5671260-5671282 CAGCCTAGGAGAGGCAGCGGGGG - Intronic
969360276 4:6658850-6658872 CAGCCCGCGCGCGGAGGCGGAGG + Intergenic
972543122 4:40056637-40056659 CCGCCTCGGCGCGGCGGCCCGGG - Intergenic
972765726 4:42151466-42151488 AAGCCCAGGCGCGGCGGCGCTGG + Intronic
972939587 4:44181283-44181305 CAGCCTCGGCTCGGCATCAGAGG - Intronic
975801062 4:78059101-78059123 GAGCCGCGGCTGGGCGGCGGCGG + Intronic
976169068 4:82284980-82285002 CAGCCTCGGGGCGGTGACCGGGG - Intergenic
976390008 4:84497676-84497698 CAGCCCCAGCGCCGCGGCCGTGG - Exonic
978224761 4:106320784-106320806 CAGCCTCGGCTCGGCATCAGAGG - Intronic
979941618 4:126770643-126770665 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
981994681 4:150963223-150963245 CAGCCTCGGCTCGGCATCAGAGG - Intronic
982712208 4:158768947-158768969 CAGCCCCACGGCGGCGGCGGCGG - Intergenic
982745995 4:159104025-159104047 CAGCCAAACCGCGGCGGCGGCGG - Intergenic
983664613 4:170167038-170167060 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
983792239 4:171813050-171813072 GAGCCGGGGCGCGGCGGCTGCGG - Intronic
983906184 4:173184556-173184578 CAGCCTCGGCTCGGCATCAGAGG + Intronic
984735053 4:183099970-183099992 CGGCCTCTGGGCGGCGGGGGTGG + Intronic
985462642 4:190121561-190121583 CCGCCGCGGCGCCGTGGCGGGGG - Intergenic
985896353 5:2751791-2751813 CAGCCTCCGGGCCGCGGCCGGGG + Intergenic
986311141 5:6551935-6551957 CAGCATGGGGGCGGGGGCGGGGG - Intergenic
986813627 5:11385042-11385064 GAGCCCCCGCGCGGCGGCGCGGG + Exonic
987373797 5:17217134-17217156 CAGCCCAGGCGGCGCGGCGGGGG + Intronic
988577841 5:32444251-32444273 CACCCACAGCGGGGCGGCGGCGG - Exonic
988595297 5:32585516-32585538 CAGCCCCAGCGCGGCGGGGCCGG + Exonic
989178778 5:38556384-38556406 CAGCCCCGGGGCGGCGGCCGAGG - Intronic
989533830 5:42540694-42540716 CAGCCTGAGAGCGGGGGCGGTGG - Intronic
992078902 5:73216145-73216167 CATCGAGGGCGCGGCGGCGGCGG + Intergenic
992105823 5:73448362-73448384 TAGCTGTGGCGCGGCGGCGGCGG + Exonic
992866246 5:80960253-80960275 CAAAGTCGGCGCGGCGCCGGCGG - Intergenic
993116147 5:83722202-83722224 CGGCCCCGGCGGGGCGGCGCGGG + Intergenic
995106247 5:108381036-108381058 CAGCCCCGCTGCGGCGGCGGGGG - Exonic
996057571 5:118998529-118998551 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
996862655 5:128083714-128083736 AAGCCTCGGCGGGGCTGCGGCGG - Intergenic
998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG + Exonic
999326937 5:150649595-150649617 CAGCCCCGCGGCGGCGGAGGAGG + Exonic
1000014691 5:157266436-157266458 GAGCTCCGGCGCGGCGGCGGGGG + Intronic
1002498515 5:179632372-179632394 CTGCCTGGCCGCGGCGGGGGAGG - Intronic
1002591100 5:180292062-180292084 CAGACCGGGCGCCGCGGCGGCGG - Exonic
1003871801 6:10410094-10410116 CAGCCTGGGTGCTGCGGCTGCGG + Exonic
1004044693 6:12012453-12012475 CGACCCCCGCGCGGCGGCGGCGG - Exonic
1004396341 6:15248820-15248842 CAGGCGCGGCGGGGCGGCGGGGG + Intronic
1004664414 6:17736436-17736458 CAGCTTCGGCTCGGCGTCAGTGG + Intergenic
1005710720 6:28501593-28501615 CAGCCTCGGCCCGGCATCAGAGG - Intergenic
1006670676 6:35728091-35728113 CAGCCCCGGCGCGCTGGCAGCGG - Intronic
1007363215 6:41373200-41373222 CAGCTCCGGCGCGGGGGCTGGGG - Intergenic
1007545141 6:42687442-42687464 CAGCCTCGGCTCGGCATCAGAGG + Intronic
1008598367 6:53065403-53065425 CATGCTCGGCGCGTCGGCGCAGG + Intronic
1008673316 6:53794981-53795003 GAAGCTCCGCGCGGCGGCGGGGG + Exonic
1010033031 6:71289293-71289315 CAGCCGCGGCGCGGAGGGGTCGG - Intronic
1013799995 6:113931624-113931646 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
1014272493 6:119349663-119349685 CAGCCCCGGCGCGGCTCAGGTGG + Exonic
1014932960 6:127355678-127355700 CAGTCTCTGGGCGGCAGCGGTGG - Intergenic
1017063331 6:150507005-150507027 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
1018950305 6:168374548-168374570 CAGCCTCGGCGAGGAGGAGCCGG - Intergenic
1019198706 6:170296810-170296832 GAGCCGCCGCGCGGAGGCGGAGG - Intronic
1019474250 7:1236436-1236458 CAGCCCCGCGGCGGCGGCGGCGG - Exonic
1019651393 7:2161144-2161166 CAGCCTCGGCTCGGCATCAGAGG - Intronic
1019689667 7:2403610-2403632 TAGTCGCGGGGCGGCGGCGGCGG + Exonic
1019711488 7:2520026-2520048 CGGGCTGGGGGCGGCGGCGGCGG + Exonic
1019718897 7:2555951-2555973 GAGCCACAGCGCGGCCGCGGAGG - Intergenic
1020418126 7:7969162-7969184 CCCCCTCGCCGAGGCGGCGGGGG + Exonic
1021231097 7:18086894-18086916 CCCCCCCCGCGCGGCGGCGGCGG + Intergenic
1022317926 7:29263066-29263088 CAGCCTCGGCTCGGCATCAGAGG - Intronic
1022715063 7:32891597-32891619 CCCCTCCGGCGCGGCGGCGGGGG + Exonic
1023773746 7:43583520-43583542 CAGCCTCGCCGCCGCGGCGCCGG - Intronic
1026522758 7:71131551-71131573 CAGCCTGCGGGCGGCGGCGGCGG + Intergenic
1026923666 7:74174301-74174323 CAGCCCCGGCGGCGGGGCGGGGG + Exonic
1027044146 7:74980604-74980626 AAGCCTCGGCGAGGTGGCAGTGG + Intronic
1027079499 7:75221754-75221776 AAGCCTCGGCGAGGTGGCAGTGG - Intergenic
1027244476 7:76358337-76358359 TAGCCTGGGCGTGGGGGCGGGGG - Intronic
1028477273 7:91265628-91265650 AACCCTCAGCACGGCGGCGGAGG + Exonic
1029461023 7:100694020-100694042 CGGGCTCGGCGCGGCCGCCGCGG + Intergenic
1029639817 7:101814099-101814121 CACACTCGGGGAGGCGGCGGGGG - Intergenic
1029927010 7:104328805-104328827 GAGCATCGCGGCGGCGGCGGCGG - Exonic
1031629730 7:124032556-124032578 CAGCCTGGGCGGCGGGGCGGGGG - Exonic
1032125191 7:129188587-129188609 CAGCCTCGGCGCAGGGGGGCCGG + Intergenic
1033220510 7:139523995-139524017 CGGCCTGGGGGCGGCGGGGGCGG - Exonic
1034639017 7:152587191-152587213 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1034733985 7:153412223-153412245 CAGCCTCGGAGCGGCCGCTGTGG - Intergenic
1035747905 8:1974533-1974555 CACCCCGGGCGCAGCGGCGGAGG - Intronic
1035752001 8:2002719-2002741 CAGCCGCGGCGAGGCGCAGGCGG + Exonic
1036454240 8:8893522-8893544 CAGCCGCGGGGAGGGGGCGGCGG + Exonic
1036910751 8:12755344-12755366 CGGCCTCGGCCCTGCGGCGCTGG + Exonic
1037134740 8:15446685-15446707 CAGCCTCGGCTCGGCATCAGAGG + Intronic
1037947798 8:22999969-22999991 CAGCAGCAGCGCGGCGGCGCCGG + Intronic
1039753320 8:40497185-40497207 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1039890693 8:41683505-41683527 CAGCCTGGGCGTGGCGGGGATGG + Intronic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1040043674 8:42940440-42940462 CAGCCTCGGCTCGGCATCAGAGG + Intronic
1043502809 8:80873845-80873867 CCGGCGCTGCGCGGCGGCGGCGG + Intronic
1044969282 8:97604392-97604414 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
1045305226 8:100951971-100951993 CAGTCTCTGGGCGGCGGCGGCGG + Exonic
1045564364 8:103298795-103298817 CGGGCTCGCGGCGGCGGCGGCGG - Intronic
1045583220 8:103500808-103500830 CGGCACCGGCGCGGCGGCTGGGG - Intronic
1047381876 8:124372074-124372096 CGGGCGGGGCGCGGCGGCGGCGG + Exonic
1048980936 8:139703207-139703229 CAGCCGCCTCGCGGTGGCGGTGG - Intergenic
1049177575 8:141203108-141203130 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1049628256 8:143636329-143636351 CAGCCTCGCGGGGGCGGCCGTGG - Intronic
1051855428 9:21559637-21559659 CGGCTTCGGCGCCGCGGCCGGGG + Intergenic
1052888893 9:33677196-33677218 CGGCTGAGGCGCGGCGGCGGCGG - Intergenic
1052941753 9:34136876-34136898 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
1054172335 9:61854018-61854040 CTGCCGCCGCGCGGCGGTGGCGG + Intergenic
1054665202 9:67726787-67726809 CTGCCGCCGCGCGGCGGTGGCGG - Intergenic
1056154148 9:83817831-83817853 GAGCCTCGGGGCGGGGGCGGGGG + Intronic
1057025572 9:91732161-91732183 CAGCCCCGGAGCTGTGGCGGAGG + Intronic
1057245535 9:93451687-93451709 CGGCCTCGCAGCGGCGGCAGCGG + Intronic
1058053328 9:100427368-100427390 CAGCGGCGGCGCGGCAGCCGCGG - Intronic
1059633943 9:116154356-116154378 CAGGCACCGCCCGGCGGCGGCGG - Exonic
1060191986 9:121599368-121599390 CGGCCTGGGCGGGGCGGTGGTGG + Intronic
1060369819 9:123058011-123058033 CAGCCTCGGCTCGGCATCAGAGG + Intronic
1060700632 9:125747001-125747023 CCGCCTGGCCGAGGCGGCGGCGG + Intergenic
1061133468 9:128720928-128720950 CAGCCTGGGCGGGGCTGGGGTGG + Exonic
1061208510 9:129177629-129177651 CAGGGGCTGCGCGGCGGCGGCGG - Exonic
1062052306 9:134453964-134453986 CAGCCTGGGAGCGGCGGCATGGG + Intergenic
1062283420 9:135762069-135762091 CAGCCCCGGCCCGGAGGCTGTGG - Intronic
1062363294 9:136197538-136197560 GAGGCTCTGCGGGGCGGCGGGGG + Exonic
1062410764 9:136423036-136423058 CAGCCTCAGCGTGGGGGCCGTGG + Intronic
1203471297 Un_GL000220v1:116451-116473 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1203479118 Un_GL000220v1:160423-160445 CCGCGTGGGGGCGGCGGCGGGGG + Intergenic
1186670236 X:11759333-11759355 CAGCCTCCTCGGGGCGGAGGGGG + Intronic
1187915767 X:24150559-24150581 CGGCGTCCGGGCGGCGGCGGTGG - Intronic
1188086263 X:25905294-25905316 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
1190108296 X:47574104-47574126 CAGCCTCGGCCCAGCGGCCCGGG - Exonic
1190285306 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG + Exonic
1190505429 X:51120445-51120467 CAGCCTCCGCTCGGCATCGGAGG + Intergenic
1190790083 X:53690972-53690994 CAGTTTTGGCGGGGCGGCGGGGG - Intergenic
1191184158 X:57592286-57592308 CAACCTAGCGGCGGCGGCGGCGG + Exonic
1191679507 X:63826276-63826298 CAGCCTCGGCTCGGCATCAGAGG + Intergenic
1195257147 X:103101848-103101870 CAGACTCAGGGAGGCGGCGGGGG + Intergenic
1195668348 X:107449912-107449934 CAGCGGCGGCGCAGCGGCGGCGG - Intergenic
1196778375 X:119361433-119361455 CAGCCTCGGCTCGGCATCAGAGG - Intergenic
1196965114 X:121047431-121047453 CAGGCCCGGCGAGGCCGCGGCGG + Intergenic
1197415266 X:126165972-126165994 CGGCGGCGGCCCGGCGGCGGTGG + Intergenic
1198733324 X:139758431-139758453 CAGCCTCGGGGGAGGGGCGGGGG - Intronic
1200155577 X:153972930-153972952 CCGCCCGGGCGCGGCGGCGGCGG + Intronic
1200173763 X:154097633-154097655 TCCGCTCGGCGCGGCGGCGGCGG + Exonic
1200324734 X:155224560-155224582 CAGCCTCGGCTCGGCATCAGAGG + Intronic