ID: 1081700054

View in Genome Browser
Species Human (GRCh38)
Location 11:45147032-45147054
Sequence GGTCCGGACGGCGCCGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081700042_1081700054 7 Left 1081700042 11:45147002-45147024 CCGGGGGTCTCGGCGCGGGCGCG 0: 1
1: 0
2: 1
3: 21
4: 132
Right 1081700054 11:45147032-45147054 GGTCCGGACGGCGCCGGCGCGGG 0: 1
1: 0
2: 0
3: 21
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081700054 Original CRISPR GGTCCGGACGGCGCCGGCGC GGG Intronic
900589850 1:3454699-3454721 GGGCCGGACCGCGCTGCCGCAGG + Exonic
901641323 1:10694538-10694560 GGCCCGGCCCGCGCCGGCCCCGG + Intronic
903652272 1:24929548-24929570 GGGCGGGAGGGCGCCGGCCCTGG - Intronic
905179161 1:36156041-36156063 GGCGCGGACGGCGCGGGCGCGGG + Intronic
905179206 1:36156170-36156192 GGCCGGGACTGGGCCGGCGCCGG + Intronic
911188759 1:94927428-94927450 GGGCCGGACCGGGCCGGCGGAGG + Intergenic
915393232 1:155562743-155562765 TGTCAAGCCGGCGCCGGCGCAGG + Intronic
922473184 1:225888998-225889020 GGTCAGGGCGGCCCCGGGGCTGG + Exonic
924948056 1:248858952-248858974 GGCCCGGGAGGCGCAGGCGCAGG - Intronic
1067071928 10:43138619-43138641 GGCCCGGGCGGTGCGGGCGCCGG + Intronic
1069452295 10:68527360-68527382 GGTCCTGATGGCGGCGGCGACGG - Exonic
1069761774 10:70816163-70816185 GGTCGGGACGGAGGCGCCGCGGG + Intronic
1069913492 10:71773482-71773504 GGGCGGGACGCGGCCGGCGCGGG + Exonic
1071086896 10:81875449-81875471 GGCCCGGACGGCGGCGGCGAAGG + Exonic
1071695459 10:87864173-87864195 GCTCCGGAGGCCGCCGGCGGAGG + Exonic
1072241180 10:93496745-93496767 GGTCCGGACCGGCCCGGCCCCGG - Exonic
1075031941 10:119029750-119029772 CGTCCGGCCCGCGCCGGCGGCGG + Exonic
1075748428 10:124743978-124744000 GGGCCGGGCGGCGGCGGCGGTGG - Intronic
1076750094 10:132538072-132538094 TGCCCGGGCGGCGCGGGCGCTGG - Exonic
1080012326 11:27472001-27472023 GGCCCGGGCGGCGGCGGGGCGGG + Intronic
1080628620 11:34052551-34052573 GGTCTGGACAGCGCCGGTGCCGG - Exonic
1081700054 11:45147032-45147054 GGTCCGGACGGCGCCGGCGCGGG + Intronic
1083289179 11:61680398-61680420 CTTCCGCAGGGCGCCGGCGCCGG - Intergenic
1083419945 11:62546885-62546907 GGGCCGGGCGGGGCCGGAGCGGG + Intronic
1083965735 11:66042672-66042694 GGCCGGGCCGGCGCCGCCGCCGG + Exonic
1083997220 11:66278415-66278437 GGCCCGGGGGGCGCCAGCGCGGG - Exonic
1085197929 11:74683514-74683536 TGACCGGGCGGCGGCGGCGCTGG - Intergenic
1085295663 11:75430320-75430342 GGCCGGGGCGGCGGCGGCGCTGG - Exonic
1086590506 11:88509274-88509296 GGTGCGGGCTGCGCAGGCGCCGG - Exonic
1088920628 11:114257846-114257868 GGTCGCGGCGGCGCGGGCGCTGG + Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1089993426 11:122882896-122882918 GGCCCGGGCGGCGGCGGCGGCGG + Exonic
1091286771 11:134412303-134412325 GGTCCCGCCGGCGCTGGCGCGGG - Intergenic
1094607272 12:31959534-31959556 GGTCCGGGCGGGGCGGGGGCCGG + Intronic
1095986251 12:48001615-48001637 GGCCCGGGAAGCGCCGGCGCAGG + Intronic
1097029188 12:56079553-56079575 GGCCCGGCCGGCGCCGGGTCTGG + Intergenic
1097896175 12:64825895-64825917 GGTCCCCAAGGCGCTGGCGCTGG - Intronic
1098105958 12:67069303-67069325 GCTCCGGGCGGCGGCGGCGGCGG + Intergenic
1103085686 12:118060876-118060898 GGTCCGCGCGGGGCCGGCGGGGG - Intronic
1114452761 14:22837631-22837653 GGGCCTGAAGGCGCCGACGCGGG - Intronic
1116426631 14:44798979-44799001 GATCCGGCCGGCGCAGGAGCGGG - Intergenic
1116835801 14:49768218-49768240 GAGCCGGGCGGCGGCGGCGCGGG - Exonic
1122300111 14:100726798-100726820 CGTGCGCACGGGGCCGGCGCCGG - Intronic
1122779903 14:104139148-104139170 GCTCCCGAAGGCGCCGGGGCCGG + Exonic
1122993302 14:105248988-105249010 GGCGCGGGCGGCGGCGGCGCTGG - Exonic
1202899796 14_GL000194v1_random:28398-28420 GGGCCCCACAGCGCCGGCGCAGG - Intergenic
1125536063 15:40441607-40441629 CGGCCGGGCGGCGGCGGCGCGGG + Intronic
1125677860 15:41512075-41512097 GGATGGGGCGGCGCCGGCGCCGG - Intronic
1127144083 15:56007190-56007212 GATCCGGGCGGCGGCGGCGGCGG + Intergenic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1129162052 15:73752661-73752683 GCTCCGGACGCCGCGGGTGCCGG - Exonic
1130305353 15:82709486-82709508 GGCCGGGGCGGGGCCGGCGCTGG + Intronic
1131144012 15:90000348-90000370 TGTCCGGCCTGCGCCGGAGCTGG + Intergenic
1131495268 15:92904288-92904310 AGGCCGGCCGGCGCCGGCGCGGG + Intronic
1132512826 16:352700-352722 CTTCCGGACGCCGCCGGCGGGGG - Intergenic
1132560228 16:590134-590156 GGGCGGGGCGGGGCCGGCGCTGG + Intronic
1136365177 16:29806411-29806433 GGCCCGGGCGGCGGCGGCGGCGG - Intronic
1136498378 16:30657897-30657919 AGTGCGGCCGGCGCAGGCGCAGG + Intergenic
1136550478 16:30979980-30980002 GGGGCGGAGGGCGGCGGCGCCGG - Exonic
1136909194 16:34132867-34132889 GACCCGGAAGGCGCAGGCGCGGG + Intergenic
1136912981 16:34159506-34159528 GGTCCGGAAGGCGCGCGCCCGGG - Intergenic
1137267973 16:46884353-46884375 GGGCCGGGCGGCGCGGGCGCCGG + Intergenic
1139917812 16:70439037-70439059 GGTCCGGACGACGGCGGCGGCGG - Intronic
1141828988 16:86498993-86499015 GGCCAGGAAGGCGCCGGCGGCGG - Intergenic
1142762340 17:2050011-2050033 CGCGCGGACGGCGCCGGCGCGGG + Intergenic
1142764082 17:2056125-2056147 GGCCCGGGCGGCGGCCGCGCGGG - Intronic
1143697178 17:8629890-8629912 GGGTCGGACTCCGCCGGCGCCGG - Intronic
1144021165 17:11241068-11241090 GCTCCGGGCGGCGGCGGCGGCGG - Intergenic
1144269083 17:13600741-13600763 GGTCCGGGCGGCTCCGGGGCCGG - Exonic
1145398432 17:22513356-22513378 GGGCAGGACGGGGCCGGGGCAGG + Intergenic
1146058661 17:29593437-29593459 GGTGCGGGCGGCGCGGGCGACGG - Intronic
1146339612 17:32007682-32007704 GGTCCGGACGTGGGCGGCGGCGG - Intergenic
1147684106 17:42276606-42276628 GGTGCGCGCGGCGCCGGCACCGG - Intronic
1149996719 17:61409640-61409662 AGGCCGGGCGGCGCCGGCGCGGG + Intergenic
1150407970 17:64919158-64919180 GGTCCGGACGTGGGCGGCGGCGG + Intronic
1150747251 17:67825806-67825828 GGTCCGGACGTGGGCGGCGGCGG - Exonic
1152208865 17:78992261-78992283 GGGCCGGAGGGTGCCGGCTCTGG - Exonic
1152599794 17:81256398-81256420 GGTCCGGACGGCAGCGTCGCTGG - Intronic
1152626533 17:81390291-81390313 GGTCGGGAGGGGGCAGGCGCTGG + Intergenic
1152659768 17:81536847-81536869 GGACGGGACGGCGTCGGCGGGGG - Intronic
1152686349 17:81695571-81695593 GGTCAGGACGGAGCTGGCTCAGG - Intronic
1152711153 17:81871070-81871092 GGACCGGGCGGCGGCGGCCCCGG - Intronic
1153805389 18:8705603-8705625 GCTCCGGACGACGACGGCGGCGG - Intergenic
1154266471 18:12883531-12883553 GGTCCAGCTGGCGCCCGCGCAGG - Intronic
1155507787 18:26549029-26549051 GGTCGGGGCGGCGGCTGCGCCGG + Exonic
1157867312 18:51197549-51197571 GGTGGGGACGGCGGCGGGGCGGG + Intronic
1158601941 18:58863509-58863531 GGGCCGGGCGGCGGCGGCGGCGG - Intronic
1158602113 18:58864069-58864091 TGCCCGGCCGGCGCCGGCGGGGG - Intronic
1160500785 18:79400365-79400387 GGTCGGGCCGGGGCCGGGGCGGG - Intronic
1160718991 19:589539-589561 TGTCCGGAGGGCACCGGCGCGGG - Intergenic
1160719128 19:589888-589910 GCTCCGGCCGGCGGCGGCGGCGG + Exonic
1160739659 19:680048-680070 GGTCCGCGCTGCGCCTGCGCTGG - Intronic
1160807874 19:1000589-1000611 GGCCAGGGCGGCGCGGGCGCGGG - Exonic
1160930665 19:1568192-1568214 GGGCGGGGCGGCGGCGGCGCGGG + Intergenic
1160930756 19:1568444-1568466 GGCCGGGGCGGGGCCGGCGCCGG + Intergenic
1161233220 19:3185972-3185994 GGACGGGACGGCGGCGGCGGCGG - Exonic
1161307964 19:3577850-3577872 GGTCCGGACACCGCCAGCGCAGG - Intronic
1161628594 19:5340236-5340258 GGGCCGGGCGCCGCCGGGGCCGG + Intronic
1161802636 19:6424550-6424572 GGTCCCGGCGGCGGCGGCCCGGG - Exonic
1162535865 19:11262516-11262538 GGGCGGGGCGGGGCCGGCGCGGG + Intergenic
1163708620 19:18832366-18832388 GGCCCGGGCGGTGGCGGCGCGGG + Exonic
1163708630 19:18832390-18832412 GGCCCGGGCGGCGCGGGCGCGGG + Exonic
1163720234 19:18895265-18895287 GGTCCGTGCGGCGGCGGGGCCGG - Intronic
1165242897 19:34481835-34481857 GGGCGGGGCGGGGCCGGCGCCGG - Exonic
1166139600 19:40799107-40799129 GGAGGGGACGGCGCCTGCGCAGG - Intronic
1166857900 19:45792428-45792450 GAGCCGGACAGCGCCGGGGCCGG - Exonic
925609845 2:5693340-5693362 GGCTCGGGCGGCGGCGGCGCGGG + Exonic
926101757 2:10122528-10122550 TCTCCGGAAGGCGCCGGCGGAGG + Exonic
926581298 2:14634376-14634398 GGCGCGGGCGGCTCCGGCGCGGG - Exonic
935237463 2:101150989-101151011 GGCCCGGACGGCCCTGCCGCGGG - Intronic
935265104 2:101387176-101387198 GGCCCGGGCGGCGCCCGCCCGGG + Exonic
935645311 2:105329624-105329646 GGGACGGCGGGCGCCGGCGCCGG - Exonic
937093956 2:119223963-119223985 GGTCCGCGCAGCGACGGCGCAGG - Intronic
937134942 2:119544466-119544488 GATTCGGCCGGCGCCAGCGCCGG - Exonic
937208608 2:120252946-120252968 GGTGCGGACGGCGGAGGCGGCGG + Exonic
941020852 2:160407272-160407294 GGCCCGGGCGGCGGCGGCGAGGG + Intronic
941111768 2:161424243-161424265 GGTCCGGGCCGCGGCGGGGCCGG - Exonic
943358776 2:186893385-186893407 GGTCAGGACGGTGCCAGCACTGG + Intergenic
944264020 2:197705226-197705248 CGTGCGGACGGCGCAGGCGCGGG + Intronic
944676022 2:202034524-202034546 AGTCCTCACGGCGCCGGGGCCGG - Intergenic
947353643 2:229271346-229271368 GGTCCGGGCGGCGGCGGCGGGGG - Intergenic
947418482 2:229921706-229921728 GGCCCCGCCGCCGCCGGCGCCGG + Intronic
948492139 2:238320556-238320578 GGACCGGGCGGCGGCGGCGGCGG + Exonic
948805417 2:240451831-240451853 GGTCTGGGCGGTGCCGGCCCTGG - Intronic
1169278644 20:4249418-4249440 GGTCCGGGGGGCTGCGGCGCTGG + Intergenic
1171499832 20:25585176-25585198 TTTCCCGACGGCGGCGGCGCGGG - Intronic
1171904655 20:30891635-30891657 GACCCGGAAGGCGCAGGCGCGGG + Intergenic
1172284648 20:33732149-33732171 GGGGCGGAGGGCGCCGGGGCTGG + Intronic
1172587265 20:36093469-36093491 GGTCCAGGCGCCGCCGCCGCTGG + Intronic
1174494596 20:50930868-50930890 GGGCCGGACAGCGGCGGCGGCGG + Exonic
1175840129 20:62021374-62021396 GGTCCGGAGGGCCAGGGCGCTGG + Intronic
1176131696 20:63499081-63499103 GGGACTGGCGGCGCCGGCGCCGG + Exonic
1176549393 21:8214729-8214751 GGTCGGGGCGGCGGCGGCGGTGG + Intergenic
1176557286 21:8258952-8258974 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1176568321 21:8397763-8397785 GGTCGGGGCGGCGGCGGCGGTGG + Intergenic
1176576228 21:8441987-8442009 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1176706009 21:10120354-10120376 GAGGCGCACGGCGCCGGCGCAGG + Intergenic
1183452945 22:37906542-37906564 GGTCGGGCCGGTGCCGGTGCAGG - Exonic
1183466666 22:37983669-37983691 GGGCCCGACGGCGGCGGCGGCGG - Exonic
1184759567 22:46537033-46537055 GGGCCGGAGGGCGAAGGCGCGGG + Exonic
1184767036 22:46577400-46577422 GGCCCGGGCGGCGGCGGCGGCGG - Intronic
1185259550 22:49853935-49853957 GCTGCGGACGACGGCGGCGCGGG - Exonic
1203254278 22_KI270733v1_random:131045-131067 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1203262334 22_KI270733v1_random:176124-176146 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
953982169 3:47418399-47418421 GGCCCGGGCGGCGGAGGCGCGGG - Exonic
954035337 3:47848224-47848246 GGCCCGCCCGGCCCCGGCGCTGG - Exonic
958714674 3:97764940-97764962 AGTCCGGAGGGCGCAGGAGCTGG - Exonic
960664216 3:120094379-120094401 GGCCCGGGCGGCGGCGGCGGCGG + Intronic
964569303 3:158094818-158094840 GCTCCAGTCGGCGCCGGGGCCGG - Intergenic
968051554 3:195658240-195658262 GGTCCGAGCGGAGCGGGCGCCGG + Intergenic
968104263 3:195990093-195990115 GGTCCGAGCGGAGCGGGCGCCGG - Intergenic
968302564 3:197627683-197627705 GGTCCGAGCGGAGCGGGCGCCGG - Intergenic
968382388 4:107738-107760 GGCCCGGGCGGCGGCGGCTCGGG + Intergenic
971195643 4:24470544-24470566 GGTCGGGCCGGCGCTGGAGCTGG - Intergenic
972265344 4:37454015-37454037 GGGCCAGACGGCGGCGGCGGCGG - Intronic
975778961 4:77819608-77819630 GGTCCGGGCGGCGGCGGCGGCGG + Intronic
982745790 4:159103338-159103360 GGCCGCGGCGGCGCCGGCGCCGG + Intergenic
985497622 5:218493-218515 GGTCCGAGCGGAGCGGGCGCCGG + Intronic
985629032 5:1005307-1005329 GGACTGGACGGCGCGGGCGTCGG + Intergenic
996404296 5:123090644-123090666 GCGCCCGCCGGCGCCGGCGCCGG - Intronic
997965454 5:138352777-138352799 GGTCAGGCCGGCCCCGGCGATGG + Exonic
999748712 5:154610648-154610670 GGTCCGGCCCGCGGCGGCGGGGG - Intergenic
1001506490 5:172284061-172284083 GGTGCGGAGGGCGGCGCCGCGGG - Exonic
1002189927 5:177473022-177473044 GGTCCGGGCGGGGACGGGGCGGG - Exonic
1002691443 5:181053264-181053286 GGTCCTCGCGGCGCTGGCGCTGG + Exonic
1002719118 5:181247123-181247145 GGTCCGGCGGGCGCAGGCACAGG - Intronic
1011610579 6:89146537-89146559 GGTCGGGGCGGCGGCCGCGCTGG + Exonic
1019429805 7:993435-993457 GGAGCGGACAGCGCCGGCCCGGG + Intergenic
1019437189 7:1028284-1028306 GGCACGGACGGCGCCGGGGCAGG + Intronic
1019453224 7:1110404-1110426 GGCCCGGGAGGTGCCGGCGCGGG - Intronic
1020278289 7:6637464-6637486 GGGCCGGTGGGCGGCGGCGCGGG + Intronic
1022363375 7:29685054-29685076 GGGCCGGAGGCCGCCGCCGCGGG - Intergenic
1028593859 7:92527929-92527951 GGCCCGGACGGCAGCAGCGCAGG + Intronic
1029483825 7:100827524-100827546 GGGCCGGGCGGCGCCGGGCCCGG + Intronic
1032391293 7:131556727-131556749 GGGCCGGGCGGGGCCGGGGCCGG + Intronic
1032787454 7:135211755-135211777 GGTCCTGGCGGCGCCGGCGGCGG + Intergenic
1033369733 7:140697128-140697150 GAGCCAGTCGGCGCCGGCGCGGG + Intronic
1034508945 7:151519277-151519299 GGTCGGGGCGGCGTCCGCGCCGG - Intronic
1035265152 7:157685996-157686018 GGCCCGGAGGGCGACCGCGCGGG + Intronic
1041167368 8:55102741-55102763 GGCCCGGGCGGCGGCGGGGCGGG + Exonic
1049558232 8:143294314-143294336 GGGCTGGGCGGCGGCGGCGCTGG - Intronic
1049570682 8:143369003-143369025 AGGCCGGACGGCGCGGGCGCCGG + Exonic
1049585410 8:143430512-143430534 GGGCGGGGGGGCGCCGGCGCGGG + Intergenic
1053198338 9:36136656-36136678 GGGCCGGGCGGCGCCGGAGGAGG + Intronic
1053919441 9:42973289-42973311 GGGCTGGAGGGCGCCGCCGCGGG + Intergenic
1054324142 9:63704701-63704723 GAGGCGCACGGCGCCGGCGCAGG + Intergenic
1054835573 9:69672290-69672312 GGTCCCGGCGGCGGCGGCGGCGG - Exonic
1055612032 9:78032441-78032463 GCTCCCTGCGGCGCCGGCGCTGG + Intergenic
1055945729 9:81689576-81689598 GGGCTGGGCGGGGCCGGCGCTGG - Intergenic
1056143637 9:83707976-83707998 GCTCCGCGCGGCGCCGGCGAAGG - Exonic
1056243067 9:84668720-84668742 GCTCCGGGCAGCGCGGGCGCAGG + Intronic
1056475174 9:86946298-86946320 GGCGCGGGCGGCCCCGGCGCGGG - Exonic
1057019110 9:91681914-91681936 GGTCCGTGCGGCGCCTCCGCGGG - Intronic
1058005168 9:99906657-99906679 GGTGGGCACGGCGCAGGCGCAGG - Exonic
1058486593 9:105448093-105448115 GGGCCGGGCGGTGCCGGTGCGGG + Exonic
1060796242 9:126514586-126514608 GGTCCGGACGCCGCAGGGGGTGG - Intergenic
1060897125 9:127225172-127225194 GTTCGGGGCGGCGCCGGGGCGGG + Intronic
1061212674 9:129202922-129202944 GGCCCGGGCGGGGCGGGCGCTGG - Intergenic
1062365173 9:136204950-136204972 GGTGCAGACGGCGGCGGCCCCGG + Intronic
1062389286 9:136327637-136327659 GGGGCGGACGGCCACGGCGCGGG + Exonic
1062461922 9:136665853-136665875 GGTCCGGTCGCCGCCCGGGCTGG + Intronic
1202800347 9_KI270719v1_random:170002-170024 GGGGCGCAGGGCGCCGGCGCAGG + Intergenic
1203470679 Un_GL000220v1:114189-114211 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1203478500 Un_GL000220v1:158161-158183 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1186917890 X:14243887-14243909 GAACCGGACGGCGGCGGCGGTGG + Intergenic
1187826190 X:23334804-23334826 GGTTCGGGCGGCGGCGGCGGCGG - Exonic
1189325731 X:40109603-40109625 GGCCCGGACGGGGTCGGCGGGGG + Intronic
1191830000 X:65406629-65406651 GGGCCGGGCGGGGCCGGCGCTGG + Intronic
1196645886 X:118116909-118116931 GGCCCCGGCGGCGCCTGCGCGGG + Intronic
1198424065 X:136497335-136497357 GATCCGGTCGGCGGCGGCGGCGG + Exonic
1200292503 X:154886393-154886415 GGCCTGGGCGGCGGCGGCGCCGG + Exonic
1200339347 X:155382133-155382155 GGCCTGGGCGGCGGCGGCGCCGG + Exonic
1200347123 X:155458560-155458582 GGCCTGGGCGGCGGCGGCGCCGG - Exonic