ID: 1081700585

View in Genome Browser
Species Human (GRCh38)
Location 11:45150138-45150160
Sequence CAGAAGGAACAGCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 781
Summary {0: 1, 1: 0, 2: 16, 3: 97, 4: 667}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081700585_1081700591 13 Left 1081700585 11:45150138-45150160 CCTTCCTCATGCTGTTCCTTCTG 0: 1
1: 0
2: 16
3: 97
4: 667
Right 1081700591 11:45150174-45150196 TTCCACCCCCTCTCCTGATGAGG 0: 1
1: 0
2: 2
3: 24
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081700585 Original CRISPR CAGAAGGAACAGCATGAGGA AGG (reversed) Intronic
900634020 1:3652935-3652957 GAGAGGGGACAGCAGGAGGAGGG - Intronic
900671745 1:3858683-3858705 GAGAAGCAACAGGAGGAGGAAGG - Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
900753019 1:4411569-4411591 CAAAAGGAAGAGGAGGAGGAAGG - Intergenic
901031234 1:6308120-6308142 CAGAAGGAACAGCCACAGGCAGG + Intronic
901031281 1:6308346-6308368 CAGAAGGAACAGCCACAGGCAGG + Intronic
901145837 1:7064153-7064175 AAGAAGGAAGAGGAGGAGGAGGG - Intronic
902519764 1:17009620-17009642 TAGGAGGATCAGCATGAGGCCGG - Intronic
902826662 1:18979243-18979265 CAGAGGGAACAGCAAGACCATGG + Intergenic
903219529 1:21861328-21861350 CAGAGGGAACAGCATAAGCAAGG + Intronic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903361007 1:22777154-22777176 CAGAAGGAACAGTATGTGTGAGG + Intronic
903390826 1:22962665-22962687 CAGATGGAACAGCACGTGGAAGG - Intronic
903489636 1:23718641-23718663 CAGCAGGAACAGCAAGGCGAAGG + Intergenic
903603527 1:24558632-24558654 CAGGAGCAACAGGATGAGGGGGG - Intronic
903744227 1:25575930-25575952 CAAAAGCAGCAGCATGAGGCTGG + Intergenic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
903818712 1:26084417-26084439 CAGAAGTGAGAGAATGAGGAAGG + Intergenic
903849263 1:26296482-26296504 CAGAGGGAACAGCAACAGCACGG + Intronic
904426038 1:30423772-30423794 CAGAAGGCAGAGGATGAGGAAGG + Intergenic
904480239 1:30788771-30788793 CAGAGGGAACAGCATGTACAAGG + Intergenic
904690038 1:32286972-32286994 CAGAGGGAACAGGGTGAGGCAGG + Intergenic
904810617 1:33161292-33161314 CAGAGGGAGCCGCATGAGGAAGG + Intronic
904928623 1:34068239-34068261 GAGAATGACCAGGATGAGGAAGG - Intronic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
906112990 1:43337082-43337104 CAGGAGCAACAGCATTAGGTGGG - Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
907412782 1:54294350-54294372 CAGAAGGAACAGTTTGTGGCAGG - Intronic
907595687 1:55717896-55717918 CAGAAGGCAGAGTATGAGCATGG + Intergenic
907610012 1:55859744-55859766 CACAAGGAACAGCATTTGGATGG + Intergenic
907659057 1:56375016-56375038 CAGAAGGAGAACCTTGAGGATGG + Intergenic
907703229 1:56810042-56810064 GAGAAGGAAGAGAAAGAGGAGGG + Intronic
907865752 1:58397659-58397681 CAGAAGGAGCAGGCTGGGGAAGG - Intronic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
907927914 1:58972053-58972075 CAGAGGGAACAGCATCACCAGGG - Intergenic
908808995 1:67959935-67959957 CAGAAAGAACAGCATCAGTGAGG + Intergenic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
909498312 1:76304516-76304538 CAGGAGGAGCAGCATGAACAAGG + Intronic
909584820 1:77278409-77278431 TAGCAGGAACAGGGTGAGGAAGG - Intergenic
910976217 1:92908850-92908872 CAGAAGGAAGAGTGTAAGGATGG + Intronic
911096162 1:94056733-94056755 CAGAAAGCACAGCATGATGGTGG + Exonic
911335586 1:96576367-96576389 CAGAAGGATTAGCAAGAGGGAGG - Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912509246 1:110177038-110177060 CAAAGGGAACTGCATGAGCAAGG + Intronic
912556087 1:110517160-110517182 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
912764637 1:112396966-112396988 CAGAAGGAACAGAAAGTAGAAGG - Intronic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
912921966 1:113877148-113877170 CATAGGGAACAGTAGGAGGAGGG + Intergenic
913234854 1:116770972-116770994 TAGAGGCAACAGCATGAGCAAGG + Intergenic
913249499 1:116900766-116900788 CAGAAGGAACACTTTGAGAATGG + Intergenic
913264812 1:117033923-117033945 CAGAAGGAGGAGCAGGACGAAGG - Exonic
913373794 1:118129647-118129669 AAGAAGGAAGAGAAGGAGGATGG - Intronic
913630972 1:120709549-120709571 CAGAAGGAACATAAGGAGAATGG + Intergenic
915287015 1:154859532-154859554 CAGATGGACCAGAATGAGCAAGG + Intronic
916043431 1:160980870-160980892 CATGAGGAATAGCAAGAGGATGG - Intergenic
916156097 1:161850264-161850286 GAGAGGGAACAGGATGAGGCTGG - Intronic
916298082 1:163242620-163242642 CAGAAGGGACAGCATAAAAAAGG + Intronic
916368183 1:164057747-164057769 GAGAAGGAAAAGGAGGAGGAGGG - Intergenic
917892677 1:179454668-179454690 GAGAAGGAAAAGTATGGGGAAGG + Intronic
918141477 1:181723797-181723819 CAGAGGGAAAGGCATGGGGATGG + Intronic
918980315 1:191549202-191549224 CAGAATTAATAACATGAGGATGG - Intergenic
919191986 1:194232191-194232213 GAGAAGGAGGAGAATGAGGAAGG + Intergenic
919732058 1:200919653-200919675 GAGAAGGTAAAGCAAGAGGAAGG - Intergenic
920804879 1:209223625-209223647 CAAAAGGAATAGCATGAGCTGGG - Intergenic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
922574897 1:226654982-226655004 GAGAAGGGAGAGCAGGAGGAGGG + Intronic
922713592 1:227852787-227852809 CAGAAGGCACAGCTTGGGTAGGG - Intergenic
922898543 1:229119075-229119097 CAGAAGGAACAGCCCTTGGAAGG + Intergenic
922953383 1:229578346-229578368 CGGAAGGAAAAGAAAGAGGAAGG - Intergenic
923235087 1:232025251-232025273 CAAAAAGAACAGCATGAGAGAGG + Intronic
923264645 1:232302558-232302580 CAGATGGACCAACATGTGGAAGG + Intergenic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924729205 1:246696663-246696685 CAAAAGGAACAGCATCATGCTGG + Intergenic
1063936963 10:11088260-11088282 CAGAGTGAACAGCATGAGTGAGG + Intronic
1064642482 10:17428654-17428676 CAGAAGGAACAGCAAGTAAAAGG + Intronic
1064943565 10:20761998-20762020 CAGAGGGAACAGCATCAGAGAGG - Intergenic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1065819785 10:29515056-29515078 GAGAAGGAAGAGATTGAGGAAGG - Intronic
1065953131 10:30669833-30669855 GAGAAGGAAGAGATTGAGGAAGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1068922686 10:62501306-62501328 CAGAGGGAAGAGCATGTGCAAGG - Intronic
1069686819 10:70324049-70324071 GAGAGAGAACAGGATGAGGAGGG + Intronic
1069991357 10:72318544-72318566 CAGAAGGAACAGCATGAGTGAGG + Intergenic
1070332592 10:75429083-75429105 TAGAAGGAACAGAAGGAGGAAGG - Intergenic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1072368251 10:94736832-94736854 CACTAGGGACAGCATGAGGGTGG - Intronic
1072608348 10:97001420-97001442 CAGGAGGAAGAGGAGGAGGAGGG + Intronic
1072783053 10:98262978-98263000 CAGCAGGAACAGAAAGAGGGTGG + Exonic
1073308182 10:102519641-102519663 CAGAAGCAGCAGCATGACCATGG - Intronic
1073330841 10:102669066-102669088 AAGAAGAAAAAGCAGGAGGAAGG - Intergenic
1073637550 10:105215052-105215074 TAAAAGTAAGAGCATGAGGATGG + Intronic
1074298266 10:112210832-112210854 CAGAGGGAACATCATGAGCCTGG + Intronic
1074324518 10:112436065-112436087 CAGAGGGAACAACATGTGCAAGG + Intronic
1075063044 10:119270016-119270038 CAGAGGGAACAGCAATAGGAAGG - Intronic
1075148045 10:119899998-119900020 CAGGAGGAGAAGCAGGAGGAAGG - Intronic
1075588973 10:123677783-123677805 GAGAAGGGACAGCATGAGCCAGG + Intronic
1075743465 10:124710128-124710150 CAGAGGGCACAGCAGCAGGATGG + Intronic
1076623913 10:131810164-131810186 CAGGAGGAAAAGCAGGATGATGG + Intergenic
1077499744 11:2903764-2903786 CAGGAGGAACAGCGCTAGGAAGG - Intronic
1077613800 11:3660935-3660957 CAGAAGAAGAACCATGAGGATGG + Intronic
1077883983 11:6372273-6372295 CAGAAGGAACAACATGTGCAAGG - Intergenic
1077897876 11:6467320-6467342 CTGAAGAAACAGCATGATAAAGG + Intronic
1078040774 11:7860936-7860958 CAGAGGGAACAGCAGGCTGAGGG + Intergenic
1078794663 11:14580332-14580354 CAGATGGAACAGCATGTTCAAGG - Intronic
1079110515 11:17602660-17602682 GAGGAGGAGGAGCATGAGGAGGG - Intronic
1080215611 11:29836617-29836639 CAGTAGGTAGAGGATGAGGAGGG + Intergenic
1080643984 11:34174822-34174844 CAGAGAGAACAGCATGAGTGAGG - Intronic
1080798969 11:35591624-35591646 CAGAAGCAACAGCAGCAGCATGG - Intergenic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1081180724 11:39983519-39983541 CAGAAGGTGAAGCAGGAGGAGGG - Intergenic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1082738278 11:56881744-56881766 CAGGAGGAAAAGGATGAAGAGGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083547183 11:63557814-63557836 CAGAGGGAACAGCGTGAGCCAGG - Intronic
1083633927 11:64109866-64109888 CGGAAGGCACAGCAGGAGCAGGG + Intronic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1083921613 11:65784114-65784136 CAGAAGGAGCATCGGGAGGAGGG + Intergenic
1084114065 11:67031692-67031714 CAGAAGGAAAAGCCCCAGGAAGG - Intronic
1084380674 11:68810562-68810584 GAGAAGGAACAGGATGTGGAGGG + Intronic
1084804456 11:71569338-71569360 CAAAAGGAACAGCAGGAAAAGGG - Intergenic
1084805999 11:71579290-71579312 CAAAAGGAACAGCAGGAAAAGGG + Intergenic
1084851354 11:71943811-71943833 CAGGAGGAGCAGCATGTGCAAGG + Intronic
1084915222 11:72423900-72423922 TAGAGGGAACAGCAGGTGGAAGG - Intronic
1085339315 11:75720998-75721020 CAGAAGGGATAGGATGGGGAAGG + Intronic
1085471686 11:76762607-76762629 AAGAAGTGACTGCATGAGGAGGG - Intergenic
1085826520 11:79853446-79853468 CTGAGGGAACAGCACGAGCAGGG - Intergenic
1086193739 11:84111782-84111804 CATGGGGAACAGCATGAGTACGG + Intronic
1086229656 11:84553051-84553073 CAGAAGGAAAAGCATGAGACAGG - Intronic
1087015096 11:93546932-93546954 TGGAAGGAACAGCATGTGGAAGG - Intergenic
1087056517 11:93941846-93941868 CAGAAGGCAAGGCATGAAGATGG + Intergenic
1087066809 11:94035162-94035184 TAGAAGGAAGAGCTTGAGAAAGG - Intronic
1087622836 11:100562423-100562445 CAGAGGGAACTGCATGAAAAGGG - Intergenic
1087982580 11:104634361-104634383 TAGAAGGAAAAGAATGAGAAAGG + Intergenic
1088134462 11:106537450-106537472 CAGAGGGAACAGTATGAGCAGGG - Intergenic
1088840150 11:113620111-113620133 CAGAAGGAACCGAAGCAGGATGG - Intergenic
1088879570 11:113962938-113962960 CAGAAGGAAGGCCATGAGGTTGG + Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089508086 11:118978373-118978395 CAGGAGGAAGAGCAAGAAGATGG + Intronic
1090057100 11:123432718-123432740 CAGCAGGAAAAGAATGAGGTTGG + Intronic
1091108158 11:132942537-132942559 CAGAAGGTACATGATGAGGCAGG - Intronic
1091239691 11:134044094-134044116 CAGAGGGAGCTGCATGGGGAAGG - Intergenic
1091533474 12:1383229-1383251 CAGAAGAAACAGGGAGAGGAGGG - Intronic
1091716165 12:2777645-2777667 TAGAGGGAACAGCATGAGCATGG - Intergenic
1091988769 12:4937456-4937478 CAGTGGGAACAGCATGTGGTGGG + Intergenic
1092286259 12:7130653-7130675 CAGAAGGGGCAGCAGCAGGAGGG - Exonic
1092400163 12:8168339-8168361 CAGATAGAAGAGCATGAGCAGGG - Intronic
1092964621 12:13629633-13629655 GAGAAGGAGGAGCAAGAGGAGGG - Intronic
1093422662 12:18992846-18992868 CACAGGGAAAAGCATGAGGCTGG + Intergenic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1095395643 12:41759333-41759355 GAAAAGGAACAGCATCAAGAAGG - Intergenic
1096050736 12:48605408-48605430 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
1096120504 12:49086240-49086262 CAGAAGGAACATCATGAGCAAGG - Intergenic
1096374778 12:51099678-51099700 CAGCAGCAGAAGCATGAGGATGG - Exonic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1098197464 12:68017131-68017153 CAGAAGGAACAGCAGCAGGTAGG + Intergenic
1098238285 12:68439996-68440018 TAGAAGGAACAGCATATGAATGG + Intergenic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098991189 12:77065874-77065896 GAGAAGGAAGAGGAGGAGGAGGG + Intergenic
1099085852 12:78244951-78244973 CAAAAGCAACAGCATGTGCATGG - Intergenic
1100245841 12:92756120-92756142 CAGAAGGACCATCATAAGAATGG - Intronic
1100362688 12:93892827-93892849 TAGAAGGAACAGCTTGATCAAGG + Intronic
1100677650 12:96885816-96885838 AAGAAGGAAGAGGAGGAGGAGGG - Intergenic
1100701364 12:97151984-97152006 CAGTAGGAAAAGCTTCAGGACGG + Intergenic
1100850149 12:98701795-98701817 AAGAAAGAACAGGAGGAGGAAGG - Intronic
1101234323 12:102773311-102773333 AAGAAGGAACAAGATGGGGAAGG - Intergenic
1101287161 12:103326627-103326649 CAGAGGGAACAGCAAAAGCATGG - Intronic
1101415953 12:104508167-104508189 CAGAAGGAACAGCAGTACAAAGG - Intronic
1101421405 12:104554318-104554340 CAGAGGGAACAGCATGTGCAAGG + Intronic
1101586718 12:106091497-106091519 TAGAAGGGTCAGCATGAGGAAGG + Intronic
1101923599 12:108953042-108953064 AAGAAAGAAAAGAATGAGGAAGG + Intronic
1102383930 12:112491105-112491127 GAGAAGAAACAGCACAAGGAAGG + Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1103043254 12:117713645-117713667 GAGAAGGGACAGTAAGAGGAAGG + Intronic
1103405961 12:120675451-120675473 CAGAGGGAACAGCATGTGTGAGG - Intergenic
1104033066 12:125079127-125079149 CACAAGGAACAGCCAGAAGAAGG + Intronic
1104081630 12:125434886-125434908 AAGAAGTTTCAGCATGAGGAGGG - Intronic
1104492057 12:129202743-129202765 CAGAGGGAATGGCATGAGGAAGG - Intronic
1104769415 12:131351650-131351672 CAGGAGGAAGAGGAAGAGGAGGG - Intergenic
1105001990 12:132696006-132696028 GAGGAAGAACAACATGAGGAAGG - Exonic
1105296612 13:19092059-19092081 CTGAAGGAGGAGCTTGAGGAAGG - Intergenic
1105923371 13:24985071-24985093 CAGAAGATACAGCAGGAGAAGGG + Intergenic
1105994001 13:25652939-25652961 CTGAAGGAACATCCTGGGGAAGG - Intronic
1106243038 13:27925301-27925323 CAGGAGGAAGAGGAAGAGGAGGG - Exonic
1106243051 13:27925350-27925372 CAGGAGGAAGAGGAAGAGGAGGG - Exonic
1106565630 13:30882074-30882096 CAGAAGTAAAAGGCTGAGGAAGG + Intergenic
1106651994 13:31701071-31701093 CAGTAGGAGCAACATGAGCAAGG - Intergenic
1106986380 13:35356819-35356841 CAGAAGGAACAGCATACAAAAGG - Intronic
1107117608 13:36763685-36763707 CAGAAGGATGGGGATGAGGAAGG + Intergenic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1112105746 13:96237347-96237369 GAGAAGGAAGAGGAAGAGGAGGG - Intronic
1112233741 13:97615465-97615487 CAGAAGGAATGGCATGAGGCAGG - Intergenic
1113130272 13:107028919-107028941 CAGCAGGAAAAGGATGGGGAGGG - Intergenic
1113922524 13:113921391-113921413 CAGAAGGAACAGCTTTAACAGGG - Intergenic
1114890983 14:26922749-26922771 AGAAAGGAACAGCATGAGGAAGG + Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1116211091 14:41945709-41945731 CAGAAGGAAGAGGAGAAGGAAGG - Intergenic
1116636190 14:47399259-47399281 GAGGAGGAACAGGACGAGGAAGG + Intronic
1116795242 14:49383260-49383282 CAGAAGGCAGAGCATGTGCAAGG + Intergenic
1116804700 14:49481524-49481546 CAGATGGACCAGGTTGAGGAAGG - Intergenic
1116872869 14:50084404-50084426 CAGAGGGAAGACCATAAGGAAGG - Intronic
1117385874 14:55212248-55212270 TAGAATGAACATCATGAGAAAGG - Intergenic
1117562709 14:56958610-56958632 CAGGAGGACCAGCCTTAGGAAGG + Intergenic
1118299917 14:64606078-64606100 CATGAGGAACAGCCTGAGGGAGG + Intergenic
1119271174 14:73306577-73306599 CAGAAGGAACAGCACTATCAGGG - Intronic
1119575941 14:75722237-75722259 AAAAAAGAACAGCATGAGGGAGG - Intronic
1119607845 14:76036086-76036108 CAGCAGGAAAGGTATGAGGAAGG - Intronic
1119650634 14:76380626-76380648 CAGCAGGAAGAGCATTACGAGGG - Intronic
1119996840 14:79262480-79262502 GAGAAGGAGGAGAATGAGGAAGG + Intronic
1120063795 14:80016031-80016053 CACAAAGAACTGCATGAGCAGGG + Intergenic
1120617660 14:86727667-86727689 CAGAACCAACAGGATGTGGATGG - Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120646969 14:87085845-87085867 CAGAAAGCACATCATGAGAATGG - Intergenic
1120927374 14:89811127-89811149 CAGAGGGAACAGCATGTGCAAGG + Intronic
1121026614 14:90620979-90621001 CAAGAGGAACAGCATGAGAGAGG + Intronic
1121182395 14:91939248-91939270 TAGAAGGAACAGCATTAACAAGG - Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121680990 14:95792598-95792620 CAGCAGGAACAGCATCAAGCTGG - Intergenic
1121950843 14:98169946-98169968 CAGAAGGACAAGCAAAAGGATGG + Intergenic
1122739906 14:103866288-103866310 AAGAAGGAACAGCTTTAGCAGGG + Intergenic
1123058603 14:105584232-105584254 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123082934 14:105704466-105704488 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123831444 15:24142603-24142625 CAAAAGGTACAACATGAGAAGGG - Intergenic
1123845635 15:24298375-24298397 CAAAAGGAACAACATGAAAAGGG - Intergenic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124073348 15:26416218-26416240 CAGAAGGAGCAGAAAGAGAATGG + Intergenic
1124349189 15:28943066-28943088 CTCAAGGAACCGCGTGAGGAAGG - Intronic
1124722063 15:32118930-32118952 CAGAAGGAACAGCCAGTGCAGGG + Intronic
1124822774 15:33063837-33063859 AAGAATGAACAGCATAAGGGTGG - Intronic
1125403670 15:39331199-39331221 GAGAAAGAAAAACATGAGGACGG + Intergenic
1125478698 15:40065063-40065085 CTGAGAGAACAGCATGAGCAGGG + Intergenic
1125736082 15:41926826-41926848 CAGAAAGAAAAGCCTGAGCAAGG - Intronic
1125748558 15:42013442-42013464 CCGAGGGAACAGCATGAACAAGG + Intronic
1125895482 15:43298322-43298344 CAGCAGGGCCAGGATGAGGAGGG + Intronic
1126510291 15:49463710-49463732 CAGAAGGAACTGTGTGAGAAAGG - Intronic
1126532096 15:49721788-49721810 GAGAAGGAACAGTATGAGAAGGG - Intergenic
1126860698 15:52879958-52879980 AAGAGGGACCAGCAGGAGGATGG - Intergenic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127232114 15:57008063-57008085 AAGAGGCAAAAGCATGAGGATGG - Intronic
1127629523 15:60814167-60814189 CAAAAGGAACAGCCTGAGTAAGG - Intronic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1127694221 15:61428623-61428645 CAGGAGGAAAACCATGAGGGAGG - Intergenic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1128157579 15:65401569-65401591 CAGAAGGAACAGGATGGGGACGG + Intronic
1128944819 15:71812995-71813017 CAGGAGGAGAGGCATGAGGAGGG + Intronic
1129117908 15:73375480-73375502 GAGGAGGAAAAGCGTGAGGAGGG + Intergenic
1129267491 15:74401748-74401770 CACCAGGAAGAGCATCAGGAGGG + Intergenic
1129322156 15:74781501-74781523 CAGAGGGAACAGCATGCACAAGG - Intergenic
1129384578 15:75188866-75188888 CAGAAGAAACATCATGGGCAAGG + Intergenic
1130042544 15:80417531-80417553 GAGAAGGAAGAGAAGGAGGAGGG - Intronic
1131102725 15:89705941-89705963 CAGAAGGAACAGCATGGGCAAGG - Intronic
1131382218 15:91973468-91973490 CAGATGCAACAGCAGGAAGAAGG + Intronic
1132006285 15:98230380-98230402 CAGCATGGGCAGCATGAGGAGGG + Intergenic
1132032520 15:98450322-98450344 TAGAAGGAGCAGCATGAGCCAGG + Intronic
1132699925 16:1217985-1218007 CACGCGGAACAGCGTGAGGAAGG - Exonic
1132769131 16:1551318-1551340 CCGAAGGATCAGCAGCAGGAGGG + Intronic
1132993255 16:2808351-2808373 CAGAAGGAACAGCATGTGCCAGG + Intergenic
1133357418 16:5146910-5146932 CAGAGGGAACAGCATGTGTGAGG - Intergenic
1133392405 16:5420937-5420959 GAGGAGGAAAAGCAGGAGGAAGG - Intergenic
1133546711 16:6814676-6814698 CACAGGGAGCAGCATGTGGAAGG + Intronic
1134095182 16:11414294-11414316 CAGAGAGAACAGAATGTGGAGGG + Intronic
1134688665 16:16176283-16176305 CACAAGGAACTGCTTGAGCAAGG - Intronic
1135054394 16:19218891-19218913 CAGAGGGAACAACATGTGCAAGG - Intronic
1135559695 16:23466781-23466803 GTGAAGGAAGAGGATGAGGATGG + Exonic
1136383470 16:29908160-29908182 CAGAAAGAGCAGCCTGGGGAGGG + Intronic
1136403766 16:30031618-30031640 CAGAAGGAAGAGCTGAAGGAGGG + Intronic
1137557136 16:49477603-49477625 AAGAAGGAAGAGGAGGAGGAGGG + Intergenic
1137918173 16:52455741-52455763 CAGAGGGAACAGCATGTGCAAGG + Intronic
1138293872 16:55870396-55870418 AAGAAGGAAGAGAAAGAGGAAGG + Intronic
1138753900 16:59458792-59458814 GAAAAGGAACAGGAGGAGGAGGG + Intergenic
1139825272 16:69752224-69752246 CAGAAGGTAAATCAAGAGGATGG - Exonic
1139923910 16:70475324-70475346 CAGAAGGACAGGCATGAGAAAGG - Intronic
1140219396 16:73032980-73033002 CAGCAGGAGCAGGATGGGGAAGG + Intronic
1140350464 16:74257579-74257601 CAGAGACAACAGCATGAGCAAGG + Intergenic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1142153159 16:88521545-88521567 GAGAGGGAACAGCATGAGGGAGG - Intronic
1142153200 16:88521686-88521708 GAGAGGGAACAGCATGAGGGAGG - Intronic
1142204430 16:88776136-88776158 CAGAAGGAACCAAATGAGGCCGG + Intronic
1142256296 16:89015331-89015353 CAGAAGGACCAGGAGGGGGACGG + Intergenic
1142332847 16:89466368-89466390 CACAGGGGACCGCATGAGGATGG + Intronic
1142420314 16:89966015-89966037 CAGAAGGAACAACTTGATGTTGG - Exonic
1143383679 17:6511982-6512004 CAGAAGGAACAGCAGGCTTATGG + Intronic
1143391438 17:6561333-6561355 GAGAAGGAAGAGGAGGAGGAGGG - Intergenic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144752977 17:17662843-17662865 GAGAAGGAACAGCAGGAGGAGGG - Intergenic
1145022728 17:19444174-19444196 CAGAAGGAAGAGCACGAAGCAGG - Intergenic
1146254843 17:31385791-31385813 CAGAGGGAACAGCATATGCAAGG + Intergenic
1146621875 17:34404969-34404991 CAGCAGGAAGACCATGTGGAAGG - Intergenic
1147376821 17:40027404-40027426 CACATGGCACAGCATGAGGAAGG + Exonic
1147772979 17:42880222-42880244 GATAAGGAACAAGATGAGGAAGG + Intergenic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1148986791 17:51629300-51629322 GAGAAGGAGAAGCATGAGCAAGG - Intergenic
1150162095 17:62907137-62907159 TAGAAGGAACAGCAGGAGAAAGG + Intergenic
1150205200 17:63399437-63399459 CAACAGGAACTGCATGAGGCTGG - Intronic
1150347149 17:64412930-64412952 CAGAAGGAACAGCACATGCAAGG - Intronic
1150836185 17:68566028-68566050 GTGATGGAACAGCATGAGGTGGG - Intronic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1152490840 17:80632298-80632320 CACAGGGATCCGCATGAGGAAGG - Intronic
1154099975 18:11463890-11463912 CAGAAGAATGAGTATGAGGAAGG - Intergenic
1154217609 18:12426863-12426885 CAGAAGGAACAGCAAAACCATGG + Intronic
1155549095 18:26946335-26946357 CAGAAGGAAGAACATGACAAGGG + Intronic
1156151313 18:34246754-34246776 CAGCAGCAACAGTATGGGGAGGG + Intergenic
1156321901 18:36033769-36033791 CATACAGAACAGCAAGAGGAAGG - Exonic
1157404760 18:47413629-47413651 CAAAAGGAACAGCATGGGCCAGG - Intergenic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1158215110 18:55092717-55092739 CATAAGGAACAGTATGTGCAAGG + Intergenic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1159231027 18:65606815-65606837 CAGGAGGAAGAGAATGAAGAGGG - Intergenic
1159664709 18:71144165-71144187 TAGAAGTAAGAGAATGAGGAAGG - Intergenic
1159824382 18:73188702-73188724 CTGAAGGAAAATCATGAAGAAGG - Intronic
1159890043 18:73944216-73944238 AAGAAGGAACAGCATGACAACGG - Intergenic
1160607813 18:80065744-80065766 GACAAAGAACAGGATGAGGAGGG - Intronic
1162873548 19:13603681-13603703 CAGAAGGAACAGCACATGCAAGG + Intronic
1163299562 19:16435325-16435347 GGGAAGGTACAGCATTAGGATGG + Intronic
1163571815 19:18086773-18086795 CAGCAGGAAGAGGAAGAGGAGGG + Exonic
1164399700 19:27894126-27894148 TAGAAGGAACAGAATGTGGAAGG - Intergenic
1164490620 19:28709884-28709906 CAGATGGGACAGCATAAGGGAGG - Intergenic
1164760971 19:30727978-30728000 CAGGAGGAAAAGGATGGGGAAGG + Intergenic
1165060271 19:33201724-33201746 CAGATGGACCAGCGTGGGGAAGG + Intronic
1165276864 19:34760750-34760772 CAGAAGGAAAAGCAAGGGCAGGG + Intronic
1165467369 19:35982891-35982913 CAGCAGGTACAGGAGGAGGAAGG - Intergenic
1166488194 19:43232576-43232598 CAAAAGGCACAGCTGGAGGATGG - Intronic
1166494861 19:43293056-43293078 CAAAAGGCACAGCTGGAGGATGG - Intergenic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167795030 19:51703446-51703468 CACAAGCATCAGCAAGAGGAGGG + Intergenic
1168326981 19:55543474-55543496 AAGAAGGAAGGGGATGAGGAAGG - Intronic
1168720640 19:58552985-58553007 CAGTAGGGAGAGCATGAAGAAGG - Intronic
1168724333 19:58572552-58572574 CAGAAGGAACAGCGCGAGGAGGG - Intronic
925025720 2:605851-605873 TAGAAGGAAAAGGAGGAGGATGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925797912 2:7566802-7566824 CAGAGGGAAGAGCATGTGCAAGG - Intergenic
926036619 2:9640826-9640848 GAGAAGGAACAGCATGTACAGGG + Intergenic
926045700 2:9708175-9708197 GAGAAGGAACAGGACCAGGAGGG + Intergenic
926135198 2:10331354-10331376 CAGGAGGAAACGCAGGAGGAGGG - Intronic
926629629 2:15124796-15124818 CAGAATGCAAAGCATGAGGGAGG + Intergenic
926906428 2:17809969-17809991 CAGCAGACACAGCAAGAGGATGG - Intergenic
927475915 2:23414119-23414141 CAGAAGAAAGAGGCTGAGGAGGG + Intronic
927582739 2:24268517-24268539 TAGAACGTACAGCATCAGGAAGG - Intronic
928831146 2:35485332-35485354 GAGAAGGAAGAGGAAGAGGAGGG + Intergenic
928964289 2:36961903-36961925 CAGAAGGAACAGCTGGGGGAAGG - Intronic
929244293 2:39685290-39685312 CAGAAGGAAGAGCATGCACAGGG - Intronic
929594870 2:43169731-43169753 CAGATGGACCACCTTGAGGAGGG - Intergenic
929904054 2:46030556-46030578 CAGAAGTAACAGCAAGAGGGAGG - Intronic
930166183 2:48205825-48205847 CGGAAGGAACAGGAGGAGAAGGG + Intergenic
930382008 2:50641903-50641925 CAGAATGGACAGCATCAAGAAGG - Intronic
930568592 2:53055488-53055510 CAGGAGGAAGAGCAAGAAGAGGG - Intergenic
930882643 2:56289507-56289529 CAGAGGGAGCAGCATGAGAGAGG + Intronic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
931965162 2:67524760-67524782 AAGAGGGAACATCATGAGGTAGG - Intergenic
931979754 2:67681940-67681962 CAGAAAGAACAGCAAGTGCAAGG - Intergenic
932088148 2:68780692-68780714 AAGAAGGAAGAGGAGGAGGAGGG - Intronic
932827378 2:74954309-74954331 CAGAAGAAACAGGAAGACGAAGG - Intergenic
933812626 2:86042593-86042615 CAGAGGGAAAGGCAGGAGGAAGG + Intronic
935100719 2:99992990-99993012 AAGAAGGAACAGAAAGGGGAGGG - Intronic
935310037 2:101774788-101774810 CAAAAGGAACTGCATGAGAGGGG - Intronic
935711858 2:105906091-105906113 GAGAAGGAGCAGCATGAGAAAGG - Intergenic
935794724 2:106630100-106630122 CAGCAGAAACAGCATGAAGAAGG - Intergenic
936159086 2:110070620-110070642 CGCTGGGAACAGCATGAGGAAGG - Intergenic
936185575 2:110300712-110300734 CGCTGGGAACAGCATGAGGAAGG + Intergenic
936946475 2:117935517-117935539 CAGATGGAACAGATTGTGGAAGG - Exonic
938143103 2:128812417-128812439 GAGGAGGAAGGGCATGAGGATGG + Intergenic
938842792 2:135179259-135179281 AAGAAAGAACAGAATGAGGCTGG + Intronic
939076552 2:137609469-137609491 CAGAGGGAACAGCAAGATCAAGG + Intronic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939401980 2:141706255-141706277 CAAAAGGCACAGCATGAGCAAGG - Intronic
939874128 2:147556970-147556992 CAGAAGGAACAGGATGGGCCAGG + Intergenic
940006364 2:149012519-149012541 CAGAAAGGACTGGATGAGGAGGG - Intronic
940716651 2:157233456-157233478 CACAAGGAATACCATGAGAAGGG - Intergenic
940910632 2:159206539-159206561 CAGCAAGAACAGCTTGATGAAGG - Intronic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
943707995 2:191056370-191056392 AAGAAGCAACAGGATGAGGCTGG + Intronic
943869250 2:192972969-192972991 TAGAAGAAACACCATGAGAAAGG - Intergenic
944808570 2:203306379-203306401 TAGAAGGAACAGGATGGGGTCGG - Intergenic
944986851 2:205187257-205187279 CAGAAGAAACAGCATAGAGACGG + Intronic
946542544 2:220700790-220700812 AAGCAGGAAGAGCAGGAGGAAGG - Intergenic
947279573 2:228434985-228435007 CAGAATGAACAGGTTGATGAAGG - Intergenic
947375362 2:229489812-229489834 CAGCAGGATAAGGATGAGGAAGG + Intronic
947585524 2:231354052-231354074 CAGAAGTAACACCATGAGCAAGG - Intronic
947720749 2:232367995-232368017 CAGAGGGCACCGCAGGAGGAAGG - Intergenic
947927932 2:233937983-233938005 CTGCAGGAACAGCCTGTGGACGG - Intronic
948422298 2:237867313-237867335 AAGAAGGAGGAGCAAGAGGAGGG + Intronic
948868880 2:240788472-240788494 CAGAGGGAACAGCATGTGAAAGG + Intronic
1168985100 20:2041146-2041168 TAACATGAACAGCATGAGGAGGG - Intergenic
1169111771 20:3038740-3038762 CAGAGAGAACAGCAACAGGAGGG - Intronic
1169208383 20:3752532-3752554 CAGGAGGAGCCGCAGGAGGAAGG + Exonic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170302834 20:14905293-14905315 CAGAAAGAATAGCATGAGCTGGG + Intronic
1170457192 20:16544243-16544265 CAGAAGGACCAGCATGAGCAAGG - Intronic
1170488408 20:16844331-16844353 CAGAAGGAAGAAAAGGAGGAGGG + Intergenic
1170614826 20:17940057-17940079 CAGGAGGAACAGCATCAGGTGGG - Intergenic
1170803643 20:19611149-19611171 CAGAAGGAACCCCATGGGGAAGG + Intronic
1170930517 20:20766219-20766241 CAGCAGGAAGAGCATGAAAATGG - Intergenic
1171154505 20:22859778-22859800 CAGAAGAAACAGCATGTGCAAGG - Intergenic
1172014123 20:31862891-31862913 CAGAGGGAACAGCATGGCAAAGG - Intronic
1172529072 20:35618040-35618062 CAGAAGGAAAAGGAAGAGAATGG - Intronic
1172934507 20:38610043-38610065 CAGCAGGAAGAGCATCAGGCTGG - Intronic
1172956983 20:38767916-38767938 CAGAAGGACTAGCATGAGCAAGG + Intronic
1173112278 20:40203205-40203227 CAGAAGGAAAAGCAAGAGGAGGG + Intergenic
1173239048 20:41277078-41277100 CAGACAAGACAGCATGAGGAAGG + Intronic
1173339322 20:42139523-42139545 CAGAAGGAACTTCAGGAGAACGG + Intronic
1173552721 20:43944470-43944492 CAGAGGGAACAGCATGAAAAAGG + Intronic
1173646880 20:44638921-44638943 CAGAAGGAACAGCATGTGCAAGG + Intronic
1173737670 20:45373291-45373313 CAGAAGGCACCGGATCAGGAGGG - Exonic
1173927811 20:46793692-46793714 CAGGAGGAACAGCATTACGGAGG + Intergenic
1175611404 20:60354280-60354302 GAGTAAGAACAGCACGAGGATGG + Intergenic
1176000966 20:62830933-62830955 CACAAGGAACACCACGTGGAAGG - Intronic
1176694661 21:9959740-9959762 GAGAAGTAGCAGCATGGGGACGG - Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1179021065 21:37641615-37641637 CAGAGGGAACAGCATTTGCAGGG + Intronic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1180855394 22:19041874-19041896 CAGCAGTGACAGGATGAGGAAGG + Exonic
1181901725 22:26161531-26161553 GAGAAGGGACAAAATGAGGAGGG + Intergenic
1182044545 22:27264100-27264122 CAGAGGAGACAGCATGTGGAAGG + Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1182444212 22:30380775-30380797 CAGGAGGAAGTGCAGGAGGATGG - Intronic
1182704506 22:32268411-32268433 CTGAAGGAACCCCATGAGGAAGG + Intergenic
1182706040 22:32281026-32281048 CAGAAGGAAAAGGCTGTGGAAGG + Intergenic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1184018015 22:41800471-41800493 CAGGAGGGACAGGACGAGGATGG + Intergenic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184763180 22:46557173-46557195 CAGAGGGAACAGCACGTGCAAGG + Intergenic
949265399 3:2151398-2151420 CAGAAGGAACAGCATGGGCCAGG + Intronic
950100562 3:10354048-10354070 CAGAGGGGACAGAATGAGCAGGG - Intronic
950454794 3:13086246-13086268 CAGAATGGACAGACTGAGGAGGG + Intergenic
950574642 3:13824708-13824730 GATAAGGAACAGCATGTGCAGGG - Intronic
950681997 3:14591888-14591910 CAGGAGGCACATCAAGAGGAAGG + Intergenic
951127186 3:18997542-18997564 CGGAAGGAACAGAATCAGCAAGG - Intergenic
951704180 3:25527173-25527195 CAGAAGGATCAGCACGATGTAGG - Intronic
951731678 3:25816352-25816374 CAGAAGGGAGAGCATGAAGATGG - Intergenic
951840145 3:27025613-27025635 GAGAAGAGAAAGCATGAGGAGGG - Intergenic
951902233 3:27668156-27668178 CAGCAGGAACAGGAAGAGAAAGG + Intergenic
952013938 3:28934428-28934450 AAGAAGGAACAGTAAGAGGGAGG + Intergenic
952929651 3:38349172-38349194 CAGAAGGAACAACATGTGCGAGG + Intronic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
954387223 3:50250480-50250502 CAAAGAGAACAGCATGAGCAGGG + Intronic
955317030 3:57947779-57947801 CAGTGGGAACAGCATGTGCAAGG + Intergenic
955812762 3:62808560-62808582 CAGAAGGAAAACCAGGAGAATGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
956540008 3:70326159-70326181 CAGAAGGAAGGGAAAGAGGAAGG - Intergenic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
957061988 3:75489739-75489761 CAGAGGGAACAGCATGTGTGAGG - Intergenic
957150282 3:76477771-76477793 CATAAGGAACAGCAGGAAGAGGG - Intronic
957166246 3:76677280-76677302 GAGAAGAAAAAGGATGAGGAGGG + Intronic
957389538 3:79546024-79546046 CAGTATGAATATCATGAGGATGG + Intronic
957550172 3:81694227-81694249 GAGAAGGAAAAGGAGGAGGAAGG + Intronic
957959845 3:87235250-87235272 CAGAAGGAATAATATGAGAACGG - Intronic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
959529117 3:107412332-107412354 TAGAAGGAACAGCATAAGCTAGG - Intergenic
960158856 3:114327264-114327286 TAGAAAGAACAGCATCAAGAAGG + Intergenic
960266384 3:115625140-115625162 GAGAAGGAGCAGGAAGAGGATGG + Intronic
960974951 3:123164440-123164462 GGGAGGGAGCAGCATGAGGAAGG - Intronic
961083126 3:124043423-124043445 CAGAAGTAATAGATTGAGGAAGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961291415 3:125849662-125849684 CAGAGGGAACAGCATGTGTGAGG + Intergenic
961313000 3:126015747-126015769 GAGATGGAAAAGCATGAGCAGGG - Intronic
961441288 3:126954801-126954823 CAGAAGACACAGCAAGAGGCTGG + Intronic
961656283 3:128443927-128443949 CAGAGGGAACAGCATGTGCAAGG + Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
961916307 3:130378671-130378693 CAGATAGAACAGCAAGAGGTGGG - Intronic
962381204 3:134899426-134899448 CAGAAGAAACAGCAGGGCGAAGG - Intronic
962674559 3:137745185-137745207 GAGAAGGAAGAGGAGGAGGAGGG + Intergenic
963043393 3:141085120-141085142 TAGAAGGAATAGCATGTGGAAGG + Intronic
963973932 3:151460086-151460108 AGGAAGGAACAGCAGGATGAAGG + Intergenic
964395572 3:156242250-156242272 CAGAAGCACCAGCAAGAGAATGG - Intronic
964728718 3:159842664-159842686 CAGAAGGAATAGCAGGTGCAGGG - Intronic
964951226 3:162296036-162296058 CTGAAAGAGCAGCATGAGAAAGG + Intergenic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
965899126 3:173617068-173617090 TAGAAGGATCAGCATGTGCAAGG - Intronic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966268696 3:178079152-178079174 CTGAATGAACAGGATTAGGATGG + Intergenic
966413448 3:179666198-179666220 GCAAGGGAACAGCATGAGGATGG + Intronic
966648078 3:182269233-182269255 CTGAAGGAACAATATGAGTAAGG - Intergenic
967215795 3:187209096-187209118 CAGATGGAACAGCATGTGTGAGG - Intergenic
967282896 3:187839547-187839569 CAGAGGGAACAGCCTGAGCCAGG + Intergenic
967598762 3:191359274-191359296 CAGAAGGAGCAGCATGCATAAGG + Intronic
968403237 4:316720-316742 CAAAAGGAACAGCAGGTGCAGGG + Intergenic
969005882 4:4019830-4019852 CAGAGGGAACAGCATGTGTGAGG - Intergenic
969293147 4:6253242-6253264 CAGAGGGAACAGCAAGTGTAAGG + Intergenic
969387784 4:6867345-6867367 CAGAAGGAACAGCAGAAGCAAGG + Intronic
969396970 4:6928216-6928238 CAGAGGGAACAGCTTGTGGCAGG + Intronic
969807067 4:9617460-9617482 CAGAGGGAACAGCATGTGTGAGG + Intergenic
969846698 4:9925162-9925184 CACAAGGAACAGCACGAGCAGGG - Intronic
969908394 4:10419548-10419570 CAGAAGGAAGAGAGTGAGGGGGG - Intergenic
970303339 4:14704261-14704283 GAGAAGGAAGAGCATGAAGCAGG + Intergenic
970422485 4:15918526-15918548 CAGAGAGAACAGCATGAGCAAGG - Intergenic
970430371 4:15983561-15983583 CAGAAGAAACGGCATGTGCATGG + Intronic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
971020401 4:22529526-22529548 GAGAGGGAACAGCTTGTGGAAGG + Intergenic
971198113 4:24488602-24488624 CAGAAGGGACAGCAGGAGACTGG - Intergenic
971231757 4:24805870-24805892 CAGCAGGAAGAGCAGGAAGATGG + Intergenic
971259447 4:25043111-25043133 GAGAAGGAACAGGCTGAGGATGG + Intergenic
971300489 4:25438136-25438158 TAGCAGGAACAGCATGTGGCTGG - Intergenic
972132082 4:35850374-35850396 GAGAAGGAAAAGCAGAAGGAAGG - Intergenic
972984008 4:44741737-44741759 CAGAAGGAACAGCATAATAAAGG - Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
973604292 4:52571227-52571249 GAGAAGGAACAGCAGGATGGAGG - Intergenic
974286149 4:59870076-59870098 CAGAAGGAACAGTTTCAGAAAGG - Intergenic
974341481 4:60619089-60619111 CAGTATGTACAGCATGAGAAAGG + Intergenic
977415484 4:96727548-96727570 AAGAAGGAAGAGTAAGAGGAGGG + Intergenic
978167457 4:105625879-105625901 AAGAAGGATCAGCATGAGGAAGG - Intronic
978682765 4:111402368-111402390 GAGAAGGAGCAGGAAGAGGAGGG + Intergenic
979576517 4:122297905-122297927 CAGCAGGGACAGCAGGAGGGAGG + Intronic
979718170 4:123866683-123866705 CAGAAGGCACAGCAGGGGGCCGG - Intergenic
980135120 4:128851264-128851286 TAGAAGTAAGAGGATGAGGAGGG + Intronic
980215403 4:129846275-129846297 TAGAAGGAACGGCATGTGGAGGG - Intergenic
980367287 4:131819965-131819987 GAGAAGTAGCAGCATGGGGATGG - Intergenic
981295600 4:143127379-143127401 TAGAAGGAAGAGGAGGAGGAAGG + Intergenic
981432720 4:144680351-144680373 CAGAATGAACAGCATGACAAGGG - Intronic
981791833 4:148546219-148546241 GAGAAGGAAGAGGATCAGGAAGG - Intergenic
982122429 4:152156077-152156099 CACAGGGAACAGCCTGAAGAGGG - Intergenic
982284820 4:153724133-153724155 GAGAAGGAAAAGGATGAGGATGG + Intronic
982753765 4:159194159-159194181 CAGAAGGAACAGTATGTGCTGGG + Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
984552732 4:181180333-181180355 TAGAAGGATCAGCATGAACAAGG - Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985329993 4:188821521-188821543 CAGAGGGAAGAGCAAGAGCACGG + Intergenic
985497421 5:217604-217626 CAGAAGGAAGACTGTGAGGAAGG + Intronic
985738166 5:1597358-1597380 CAGAAGGAAGACTGTGAGGAAGG - Intergenic
986614995 5:9606825-9606847 GAGAAGGATCAGCCTGAGGAAGG + Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987092651 5:14521849-14521871 CAGCAGGGTCAGCATGAGAAAGG + Intronic
987190912 5:15477446-15477468 GACAAGGAAAAACATGAGGAAGG + Intergenic
988836072 5:35033559-35033581 GAGAAGAAACAACAGGAGGATGG + Intronic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989634626 5:43521054-43521076 GAGGAGGAACAGCATGAAGATGG + Intergenic
989642608 5:43597932-43597954 CTGAAGGAAAAGCATGCGAAAGG + Intergenic
989661125 5:43798446-43798468 CAGAGGGGGCAGCTTGAGGAGGG + Intergenic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
991170011 5:63613900-63613922 CTGAATGAACTGCATGAAGAGGG + Intergenic
991406477 5:66305397-66305419 CAGAGGGAACAGCATGTGCAAGG + Intergenic
992006751 5:72485889-72485911 CAGAAAGAACAGCAAGTGAAAGG - Intronic
992391476 5:76335197-76335219 GAGAAGGAACAGCCTGCAGAGGG - Intronic
992625496 5:78632927-78632949 CAAAAGGAACAGCAAGACGGGGG + Intronic
992836531 5:80647318-80647340 AAGAAAGAACAGCATGAAGATGG + Intronic
993168465 5:84385036-84385058 CAGAAGGAGCTGAAAGAGGAGGG - Intergenic
993378729 5:87180948-87180970 CAGAAGGAAAAGCAAGGGAATGG + Intergenic
993390837 5:87318547-87318569 CAGGAGAAACAGCATGTGAAGGG + Intronic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994194369 5:96906204-96906226 GAGAAGGAAGAGGAGGAGGAGGG - Intronic
994849769 5:105039109-105039131 CAGAAGGAAGAGAGAGAGGAGGG - Intergenic
995194782 5:109352562-109352584 CAGAAAGAACATCATGAGATAGG - Intronic
995705792 5:114988438-114988460 CAAAAGGAAAAGCATCAGGGTGG - Intergenic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996118281 5:119643137-119643159 CAAAAGGACAAGCATGAGCAAGG - Intergenic
996439566 5:123474354-123474376 CAGATGGCACAGCAATAGGATGG + Intergenic
996471117 5:123861717-123861739 CAAAACAAACAACATGAGGATGG - Intergenic
997338803 5:133126580-133126602 CAGAAGGGACATCATGGGCAAGG + Intergenic
997509946 5:134447186-134447208 AAGAAAGAACAGGAGGAGGAGGG + Intergenic
997722477 5:136090423-136090445 CAGTAGGAACAGCATGGTGAAGG + Intergenic
998660887 5:144236372-144236394 CAGAAGGAACAGCATATGCAGGG + Intronic
999412744 5:151366561-151366583 CAGGAGGCACAGGATGATGAGGG + Intergenic
999813081 5:155146581-155146603 ACGAGGGAACAGCATGAGTAGGG - Intergenic
999862921 5:155667818-155667840 CACAAGGAACAGCAAGTGCAAGG - Intergenic
1000628726 5:163567774-163567796 AGGAAGGAAGAGAATGAGGAAGG - Intergenic
1001026343 5:168227354-168227376 CGGCAGTAAAAGCATGAGGATGG + Intronic
1001144880 5:169175141-169175163 AAGAAGGAACAAAATGAAGAAGG + Intronic
1001306581 5:170578896-170578918 CAGAAGGAATAGCAAGAGGGAGG + Intronic
1001314476 5:170632681-170632703 GAGAAGGCACAGCAGGAGGCTGG - Intronic
1001903703 5:175453250-175453272 AAGAAGGAAGAGGAGGAGGAGGG + Intergenic
1002154911 5:177269623-177269645 TGGAAGGAACAGCTCGAGGATGG - Exonic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1003022620 6:2524324-2524346 CAGAGGGCACTGCAGGAGGAAGG - Intergenic
1003049614 6:2767307-2767329 GAGAAGAACCAGCATCAGGAAGG + Intronic
1003422259 6:5969060-5969082 CAGAAGGACCAGCACAGGGAGGG + Intergenic
1003843729 6:10150357-10150379 CACAAGGAATAGGAAGAGGAGGG - Intronic
1004076726 6:12350689-12350711 CAGGAGGAAGAGAATGAAGAGGG + Intergenic
1004184794 6:13412717-13412739 CAGAAGGGAAGGCAAGAGGAGGG - Intronic
1004334271 6:14750070-14750092 GAGCAGGAAGAGCATGAGGAAGG - Intergenic
1004410176 6:15374201-15374223 CAGAAGAGGCAGCATGCGGAAGG + Exonic
1005637339 6:27764839-27764861 CAGAAGGGACTCCATGGGGAAGG - Intergenic
1005676314 6:28159074-28159096 CAAAAAGAATAGCATGAGAAAGG - Exonic
1005890915 6:30137049-30137071 CAGAAGGACAACCAGGAGGAGGG + Exonic
1006094073 6:31644900-31644922 GAGCAGGATCAGCATGATGAGGG - Intronic
1007060873 6:38939891-38939913 GAAATGGAACAGCATGAGAAAGG + Intronic
1007102325 6:39257832-39257854 GAGAAGGAAAAGCATGGTGATGG - Intergenic
1007222945 6:40293469-40293491 CAGCAGGAACAGCATCAGGCTGG - Intergenic
1007787954 6:44292252-44292274 CAGAGGGAACAACTTGAGCAAGG - Intronic
1007883890 6:45203706-45203728 CAGAAGGCTCTGCATGAGGCTGG - Intronic
1008202739 6:48612158-48612180 AAGAAGGAAAAGGAGGAGGAGGG - Intergenic
1008620573 6:53267203-53267225 CAGAGGGGACAGCATTAGGGTGG + Intergenic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1008934088 6:56970657-56970679 CAGAAGGAACATTATGAATATGG - Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1009652977 6:66499901-66499923 CAGAAGGAAGAGAGAGAGGAAGG - Intergenic
1009677045 6:66838952-66838974 GAGACGGAATAGCACGAGGAGGG + Intergenic
1010333329 6:74650216-74650238 AAGAAGGAAGAGTATGGGGAAGG - Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1011623978 6:89268747-89268769 CAGAAGGTACAGTATGTGGAAGG + Intronic
1012802706 6:103852507-103852529 CAGAAAGAACATTATGAGAAAGG + Intergenic
1012980975 6:105830806-105830828 CAGAAGGGGCAGCTGGAGGAGGG + Intergenic
1012981135 6:105831234-105831256 GAGAAGGGACAGCTGGAGGAGGG + Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014034553 6:116750494-116750516 CACAAAGCACAGCATGAGTAAGG - Intergenic
1014894787 6:126888703-126888725 TAGAAGATACAACATGAGGAAGG - Intergenic
1016523040 6:144968005-144968027 CAGAAGGGAAAGCATGTGTAAGG - Intergenic
1016524774 6:144989370-144989392 GAGAAGGAAGAGCATGTGCAAGG - Intergenic
1016728360 6:147401087-147401109 CTGAAGCAACAGCCTGAGCAGGG + Intergenic
1017180517 6:151547525-151547547 GAGAGGGAACAGCATGAGTTGGG + Intronic
1017909726 6:158782473-158782495 TTCAAGGAACAGCATGAGGCTGG + Intronic
1017949127 6:159120892-159120914 CTGAAGCAATAGCAGGAGGAAGG - Intergenic
1018082387 6:160269794-160269816 CACAGGGTAGAGCATGAGGATGG - Intronic
1018204184 6:161421483-161421505 AAGCAGGACCAGCATGAGGGTGG + Intronic
1018909923 6:168096042-168096064 CACACGGAACACCGTGAGGACGG + Intergenic
1018911486 6:168102843-168102865 CAGAAGGAAGAGGAGGAGAAGGG - Intergenic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019648069 7:2141553-2141575 AAGAAGGCACCGCATGAGGGAGG + Intronic
1019654152 7:2179572-2179594 CAGAGGGAACAGAATGGGGCTGG + Intronic
1019756479 7:2774450-2774472 CAGAAGGAACAGCAAGCACAAGG + Intronic
1020035832 7:4962555-4962577 GAGAAGGAAGAGGAGGAGGAGGG + Intergenic
1020156402 7:5728196-5728218 CAGAAGGGCCACCCTGAGGAAGG - Intronic
1020601958 7:10286742-10286764 GAGAAAAAACAGCATGGGGAAGG + Intergenic
1021073379 7:16271598-16271620 CAGAAGTAACAGTATGTGAAAGG - Intronic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1021603627 7:22389320-22389342 CAGAGGGAACAGTAAGAGAAAGG + Intergenic
1021759106 7:23886032-23886054 CAGGAGGAACAGCAAGTGGAAGG + Intergenic
1021840954 7:24721538-24721560 CTGACGGAACCCCATGAGGAGGG - Intronic
1022236638 7:28467818-28467840 CAGAAGGAACTTCTTCAGGATGG + Intronic
1022254027 7:28637660-28637682 CAGAAGAAACAACAGGACGAAGG + Intronic
1022514468 7:30966481-30966503 CAGAAAGCACAGCATGTGCAAGG - Intronic
1022606122 7:31815793-31815815 CAGAAGGAACTGGATGAGCAGGG + Intronic
1022793638 7:33714499-33714521 GAAAAGGAACAGCAGGAGCAGGG - Intergenic
1022950225 7:35331648-35331670 CAAAAGGCACAGCATTGGGAAGG - Intergenic
1023464557 7:40439757-40439779 CTGAAAGCACAGCATGAGCATGG - Intronic
1023608731 7:41953714-41953736 CAGAACTAACAGCAGGTGGATGG + Intergenic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1024513995 7:50228079-50228101 CAGAAAGGACAAAATGAGGAAGG - Intergenic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1025106849 7:56178110-56178132 CAGGAATAACATCATGAGGAAGG - Intergenic
1025871554 7:65439118-65439140 AAGAGGGAACAGTATGAAGAGGG - Intergenic
1026381057 7:69799790-69799812 CTCAAGGAACAGCACCAGGAGGG - Intronic
1026617343 7:71917228-71917250 CAGAAACAACAGGATGAGGCAGG + Intronic
1026977944 7:74510035-74510057 CAGCAGGAACAGCTTGAAGGAGG - Intronic
1027267480 7:76502410-76502432 CAGGAGGCACAGCAGGTGGAAGG - Exonic
1027319295 7:77002275-77002297 CAGGAGGCACAGCAGGTGGAAGG - Intergenic
1027965435 7:84999675-84999697 CAGAGGGCAGAGCATGAGGAGGG - Exonic
1028210339 7:88066741-88066763 CAGAAGCAGCAGCAAGAGAAAGG + Intronic
1028357081 7:89923526-89923548 CATCAGGTACAGCAAGAGGATGG - Intergenic
1028763096 7:94517303-94517325 CAGAAGGAACTGCCAGAGCAGGG + Intronic
1029473666 7:100770070-100770092 CAGATGGAAAAGCATGAGGAAGG + Intronic
1029935647 7:104421673-104421695 CAGAAACAATAACATGAGGAAGG + Intronic
1030640043 7:111994461-111994483 AAGAAGGAACAGCATCAGAAGGG + Intronic
1030978802 7:116161949-116161971 CAGTAGGCACAGCATGTGTAAGG + Intergenic
1031188746 7:118518784-118518806 CAGAAAGAAATGCTTGAGGAAGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1031975287 7:128089783-128089805 CAGCAGGAACAGCAGGATGGTGG - Intronic
1032139554 7:129315084-129315106 CAGAAGGAAAAAAATGAAGATGG - Intronic
1032210707 7:129911396-129911418 CAGAACAAACAGGATGAGGGAGG + Intronic
1032429117 7:131846550-131846572 GAGTAGGAACAGCAGGAAGATGG + Intergenic
1032533607 7:132642507-132642529 GAGAAGGAACAGCATGCACAGGG + Intronic
1033031085 7:137827458-137827480 CAGCAGGAATTGCATGAGAAAGG - Intronic
1033135559 7:138781218-138781240 CATAAGGACCAGCAGGAGCAGGG - Intronic
1033240415 7:139674517-139674539 CAGGAAGAAAGGCATGAGGATGG + Intronic
1033619860 7:143052423-143052445 GAGAAGATAAAGCATGAGGAAGG - Exonic
1033952762 7:146805572-146805594 AGGAAGGAACAGCAAGAGGGAGG + Intronic
1034300471 7:150010817-150010839 CAGATGGAACAGAATGAGAAAGG + Intergenic
1034546078 7:151790226-151790248 GAGCAGGAAGAGCAAGAGGAAGG - Intronic
1034805583 7:154086491-154086513 CAGATGGAACAGAATGAGAAAGG - Intronic
1035344522 7:158189352-158189374 CCGAAGGAGGAGCATGATGATGG + Intronic
1036076145 8:5503042-5503064 CAGATGGAGCAAAATGAGGAAGG - Intergenic
1036645623 8:10610156-10610178 AAGAAGGAACAGAAGGAGAAGGG - Exonic
1036755941 8:11471197-11471219 CAGAGGGAACTGCATCTGGAAGG + Intronic
1036912607 8:12769809-12769831 CAGAAGGAAAAGGATAAAGAGGG - Intergenic
1036924418 8:12891013-12891035 CAGAAGGGACAGTGTGAGCAAGG - Intergenic
1037339817 8:17832286-17832308 CAGAAGGAACGGAAGGAGGAAGG + Intergenic
1038175297 8:25176843-25176865 CAGAAGGAGCAGCATAACTAAGG - Intergenic
1038260558 8:25989834-25989856 CAGAAGCAACAGCAGCAGCAAGG + Intronic
1039854007 8:41397171-41397193 AAGAAGGAGCAGCAAGACGAAGG + Intergenic
1040554891 8:48469757-48469779 CAGAAGGGAGAGCGTGAGCAAGG + Intergenic
1040785848 8:51161128-51161150 CAGGTGGGACAGCCTGAGGAGGG + Intergenic
1041193253 8:55374635-55374657 CAACAGGAAGAGCATGGGGATGG + Intronic
1041686222 8:60647467-60647489 CAGAAAGAACAGCATATGCAAGG + Intergenic
1041899762 8:62968722-62968744 TAGAAGGCACGGCCTGAGGAAGG - Intronic
1042573790 8:70195922-70195944 CAGAAGGAACAGCATTATAGGGG + Intronic
1042702846 8:71635682-71635704 AAGAATGAACCGCCTGAGGATGG - Intergenic
1042770265 8:72372895-72372917 CAGAAGAAACAGCATTTGCAAGG - Intergenic
1043129602 8:76444705-76444727 CAGAAGGTACAGAATGAAAAGGG + Intergenic
1044283595 8:90385132-90385154 CAGAAGGATCAGCTTGAGCAAGG - Intergenic
1047093832 8:121602370-121602392 CAGTAGGAAAAGCATGATGTTGG - Intergenic
1047184752 8:122622803-122622825 AAAAAGGAACAGCATGAAGACGG - Intergenic
1048341412 8:133541823-133541845 CAGAAGTAACAGCAAGGGAAAGG + Intronic
1048629022 8:136220350-136220372 GAGAAGGAACAGAAAGAGAAGGG + Intergenic
1048911987 8:139144017-139144039 CAGATGGAACTGCATGAGGGAGG - Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049850686 8:144828539-144828561 CAGCAGGAATAGCATGTGAAAGG - Intronic
1052284005 9:26763786-26763808 CAGAAGGAAAAGAGAGAGGAAGG - Intergenic
1052446472 9:28567886-28567908 GAGTAAGAACTGCATGAGGAGGG - Intronic
1052484317 9:29076499-29076521 CAGAAGGAACAGAATGAGTATGG + Intergenic
1052900820 9:33793576-33793598 CAGGAAGAAAAGCAGGAGGAAGG + Intronic
1052902362 9:33804271-33804293 CAGGAAGAAAAGCAGGAGGAAGG + Intergenic
1053294186 9:36901262-36901284 CAGAAGGAACAGCATGATAAAGG - Intronic
1053631631 9:39945680-39945702 GAGAAGTAGCAGCATGGGGACGG - Intergenic
1053774131 9:41517850-41517872 GAGAAGTAGCAGCATGGGGACGG + Intergenic
1054212256 9:62305018-62305040 GAGAAGTAGCAGCATGGGGACGG + Intergenic
1054312729 9:63543814-63543836 GAGAAGTAGCAGCATGGGGACGG - Intergenic
1055153715 9:73035548-73035570 AAGAAGGAACATCTTGAGGGAGG + Intronic
1055160668 9:73122743-73122765 CAGAAGGAACTGAATTAGAAAGG + Intergenic
1055854938 9:80674424-80674446 TAGAATGCAAAGCATGAGGAAGG + Intergenic
1056067244 9:82949352-82949374 CAGCAAGAACAGCATGAGCGTGG + Intergenic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057282762 9:93724816-93724838 CACAGGGAAGAGCATGAGCAAGG + Intergenic
1057696753 9:97328625-97328647 CAGAGGGAGCACGATGAGGAAGG - Intronic
1057954866 9:99399564-99399586 TAGAAGGCACAGGATGGGGAAGG - Intergenic
1058183787 9:101829906-101829928 GAGAAAGAAGAGCATGAGAAAGG - Intergenic
1058505438 9:105661511-105661533 GAGCAGGAACAGAATGATGAAGG - Intergenic
1058808935 9:108620286-108620308 AAGAAGGAAAAGGAGGAGGAGGG + Intergenic
1058921374 9:109618581-109618603 AAGAAGAAATACCATGAGGATGG - Intergenic
1059035680 9:110751392-110751414 GAGAAAGACCAGAATGAGGATGG + Intronic
1059174404 9:112155926-112155948 AAGAAGGAAGAGAAGGAGGAAGG + Intronic
1059710780 9:116865779-116865801 CAGAAGGAAGAGCATGATTTGGG - Intronic
1059772300 9:117438813-117438835 AAATAGGAACAGCATCAGGAAGG + Intergenic
1060030153 9:120207759-120207781 CAGAAGGAACAGCAAGTCAATGG - Intergenic
1060849974 9:126866483-126866505 CAGAAGGAAAAGCAGGAACAGGG - Intronic
1060853181 9:126894499-126894521 CAGAGGGAACAGCACGTGCAAGG + Intergenic
1060896686 9:127223437-127223459 GAGAAGGAGCAGGATGAGGCTGG + Intergenic
1061201180 9:129139380-129139402 CAGAAGGAACAGGGAGGGGAGGG + Intronic
1061204814 9:129156750-129156772 CAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1061212842 9:129203518-129203540 CAGAGGGAACAGCATGAAGGAGG + Intergenic
1061239130 9:129358980-129359002 CAGCAGGGACAGCATGTGCAAGG - Intergenic
1061803739 9:133127057-133127079 CAGAAGGGGCGGCATGAAGAAGG - Intronic
1061864613 9:133485842-133485864 CAGGAGGAACAGCAGGACAAGGG - Intergenic
1062316603 9:135970444-135970466 GAGGAGGGACGGCATGAGGAGGG - Intergenic
1062744648 9:138203574-138203596 GACAAGGAAGAGAATGAGGAGGG + Intergenic
1185480223 X:440743-440765 CAGCAGCAGCAGCCTGAGGAAGG - Intergenic
1186261529 X:7785209-7785231 CAGAAGGCAAAGCAGGAGAAAGG + Intergenic
1186404207 X:9287466-9287488 CAGTAGGAACAGCAAGAGCAAGG - Intergenic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1186645430 X:11501838-11501860 GAGAAGGAGCAGGAAGAGGAGGG + Intronic
1186898333 X:14027608-14027630 AAGAAGGCATAGCATGGGGAAGG + Intronic
1187416419 X:19097102-19097124 CGGAAAGAAGAGCATAAGGAGGG - Intronic
1188063590 X:25630499-25630521 CAGAAGGAACAGCAGAAGAGAGG - Intergenic
1188134199 X:26474229-26474251 AAGAGGGACCAGTATGAGGAGGG + Intergenic
1188202415 X:27307796-27307818 AAAAAGGAAAAGCATAAGGATGG - Intergenic
1188329191 X:28847643-28847665 CAAAAGGAACAGCAAGTGCAAGG - Intronic
1188338289 X:28966531-28966553 CAAAAGCAACAACAAGAGGAGGG - Intronic
1188522488 X:31054278-31054300 CAGAAGAAACAGGATGGGGTAGG + Intergenic
1189161927 X:38817924-38817946 CAGAAGCAACATTATGAAGAAGG + Intergenic
1189511653 X:41668363-41668385 TAGAAGGAATAGCATGTGCAAGG + Intronic
1189540246 X:41979985-41980007 CAGAAGGAACAGAAAAAGGAAGG + Intergenic
1190108148 X:47573552-47573574 GAGGAGGAAAAGTATGAGGATGG + Intronic
1190533784 X:51407047-51407069 CAGAAGCACCAGCAGGACGAGGG + Exonic
1191182087 X:57574967-57574989 CAGTAGGAACAGCATGTGTGTGG - Intergenic
1192779176 X:74276933-74276955 CAGAAAGAAGAGTAAGAGGAGGG + Intergenic
1193189105 X:78548572-78548594 AAGAAGGCACAGGAGGAGGAGGG - Intergenic
1193810828 X:86048688-86048710 CTGAAAGAACAGCATGAGCGTGG - Intergenic
1194079404 X:89439932-89439954 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1195245151 X:102988645-102988667 CAGAAGCAAGAGCATGGGGAAGG - Intergenic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1196188757 X:112772937-112772959 CAGAAGGCATAGCATGTGCAAGG - Intergenic
1196779891 X:119374461-119374483 CAGAAGAAACTGCATGTGCAAGG + Intergenic
1196824710 X:119732019-119732041 CAGCAGGACCAGCAGAAGGAAGG + Intergenic
1196843571 X:119880689-119880711 CAGAGGGAACAGCATAAGGGTGG + Intergenic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1197645766 X:129015124-129015146 CAGAAGAAGCAGCAAGAAGATGG - Intergenic
1197882470 X:131181349-131181371 CAGAAGGAAGAGAAACAGGAAGG - Intergenic
1198610674 X:138396244-138396266 CAGAAGGCAAAGCAGGAGCAGGG - Intergenic
1198617253 X:138472852-138472874 CAGAAGAAACATCGTGAAGATGG - Intergenic
1198666160 X:139025542-139025564 CAGAAGGAACAGAAAGATGTGGG - Intronic
1200069003 X:153518607-153518629 CAGAAGGGCCAGCAGAAGGAAGG - Intronic
1200283838 X:154802116-154802138 CAGAGGGAACAGCCTGTGCACGG - Intronic
1200432022 Y:3095237-3095259 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1201889005 Y:18920954-18920976 CAGAAGGAACATCATCAGGTGGG + Intergenic