ID: 1081702378

View in Genome Browser
Species Human (GRCh38)
Location 11:45159894-45159916
Sequence CTGCAGAAACAGAATGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 330}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081702368_1081702378 11 Left 1081702368 11:45159860-45159882 CCTGAAGCTGGTCACAATTGGCC 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG 0: 1
1: 0
2: 2
3: 39
4: 330
1081702363_1081702378 23 Left 1081702363 11:45159848-45159870 CCCTGAAGCATCCCTGAAGCTGG 0: 1
1: 1
2: 1
3: 17
4: 210
Right 1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG 0: 1
1: 0
2: 2
3: 39
4: 330
1081702375_1081702378 -10 Left 1081702375 11:45159881-45159903 CCAGGGCTGGGGGCTGCAGAAAC 0: 1
1: 0
2: 5
3: 57
4: 543
Right 1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG 0: 1
1: 0
2: 2
3: 39
4: 330
1081702365_1081702378 22 Left 1081702365 11:45159849-45159871 CCTGAAGCATCCCTGAAGCTGGT 0: 1
1: 0
2: 3
3: 18
4: 169
Right 1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG 0: 1
1: 0
2: 2
3: 39
4: 330
1081702362_1081702378 30 Left 1081702362 11:45159841-45159863 CCTTTATCCCTGAAGCATCCCTG 0: 1
1: 0
2: 0
3: 26
4: 204
Right 1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG 0: 1
1: 0
2: 2
3: 39
4: 330
1081702367_1081702378 12 Left 1081702367 11:45159859-45159881 CCCTGAAGCTGGTCACAATTGGC 0: 1
1: 0
2: 1
3: 4
4: 95
Right 1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG 0: 1
1: 0
2: 2
3: 39
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081702378 Original CRISPR CTGCAGAAACAGAATGGGCC AGG Intronic
900269678 1:1780748-1780770 CAGCAGGAACAGAAGGGTCCAGG + Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901619807 1:10574813-10574835 CAAAAGAAACAGAATTGGCCGGG + Intronic
904205074 1:28849067-28849089 CAGCAGACACAGAAAGGGTCAGG + Intronic
904357933 1:29953447-29953469 CTGCAGAAATAGAAAGAGCCTGG + Intergenic
904456826 1:30652777-30652799 CTGAAGAAATAGAGTGAGCCAGG + Intergenic
904933215 1:34107062-34107084 CAGCAGCAAGAGAAAGGGCCAGG + Intronic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905659037 1:39706515-39706537 CTGCATATACAAAATAGGCCAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
906030219 1:42713916-42713938 CAGCAGAAACCGTATAGGCCAGG - Intergenic
906265875 1:44428943-44428965 CTCTAAAAACAGAATGGGGCAGG - Intronic
906566765 1:46806468-46806490 CTGCAGAAAGAGACTAAGCCAGG + Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
907407973 1:54265414-54265436 CTGCACACCCAGCATGGGCCTGG + Intronic
908024539 1:59936716-59936738 CTGCACAAACATCAAGGGCCAGG + Intergenic
909852219 1:80482415-80482437 CTTCAGAGAGAGCATGGGCCTGG + Intergenic
910080419 1:83334910-83334932 TAGCAGAACTAGAATGGGCCAGG + Intergenic
911288537 1:96027929-96027951 CTGCAGGAACAGTGTGGGGCAGG - Intergenic
913064534 1:115238424-115238446 ATTCTGAAACAGAATGGGCAAGG + Intergenic
913230511 1:116737045-116737067 CTGCAGATACAGATGGGGTCTGG + Intergenic
914686484 1:149984367-149984389 CTGCAGAAAGAGAATGGCACTGG + Intronic
914942166 1:152032807-152032829 CTGCAGAACCAGAAGGACCCTGG - Exonic
915677708 1:157547166-157547188 CTGGAGGAAAATAATGGGCCTGG + Exonic
919081981 1:192878202-192878224 CTACAGAATCAGTATGGTCCAGG + Intergenic
920017376 1:202923807-202923829 CTGCTGAATCAGAATGGGAGAGG - Intronic
920330557 1:205204307-205204329 CCGCAGAAGCAGAATTGGACTGG + Intronic
920722169 1:208398015-208398037 ATGCAAAAACTGAATGGGGCAGG + Intergenic
920786417 1:209046451-209046473 TTGCAGAAACAGGCTGGGCACGG - Intergenic
920793120 1:209111559-209111581 CTGCACAAACAGACTGAGACAGG + Intergenic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
922024068 1:221734301-221734323 TTGCAAAAACATATTGGGCCAGG - Intronic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
923155855 1:231278854-231278876 CAGCAGAAACAGCCTGGTCCTGG - Intergenic
924015150 1:239713066-239713088 TTGCAGAAGCAGATTGTGCCCGG - Intronic
924225917 1:241921529-241921551 ATAAAGAAACAGCATGGGCCAGG + Intergenic
924242653 1:242055907-242055929 CTGAAGAACTAAAATGGGCCAGG + Intergenic
924391839 1:243569196-243569218 CTGCAGAAACTGAATGACCATGG + Intronic
924488491 1:244511871-244511893 CAGCAGAAACCTAATAGGCCAGG - Intronic
924861542 1:247928797-247928819 CTAAAGAAACAGGATGGGCCGGG + Intergenic
1063536431 10:6888509-6888531 ATCCAGAAACAGAAAGGCCCAGG + Intergenic
1064770615 10:18718709-18718731 TTACATACACAGAATGGGCCAGG - Intergenic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065686826 10:28293958-28293980 CTGCAGAAAGAAAATGAACCAGG + Intronic
1065925515 10:30431809-30431831 CGGCAGAAGCAGCCTGGGCCGGG - Intergenic
1066459363 10:35599678-35599700 CTTCAGAAACAGCAGAGGCCGGG - Intergenic
1067420445 10:46140850-46140872 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067425576 10:46208683-46208705 CTGGAAAGACAGAATGGGGCTGG - Intergenic
1067505789 10:46847331-46847353 CTGGAAAGACAGAATGGGGCTGG + Intergenic
1067966939 10:50923632-50923654 CTGCACAAACAGCAAGGCCCTGG + Intergenic
1071800419 10:89054068-89054090 CTGCATCAACATAATGGGCAGGG - Intergenic
1072009378 10:91290277-91290299 CTGCAGAAAGAGGTAGGGCCGGG + Intergenic
1072252551 10:93593111-93593133 GTAGAGAAACAAAATGGGCCAGG - Intronic
1072495845 10:95958193-95958215 ATGCATAAACAAAATAGGCCGGG + Intronic
1072708040 10:97696308-97696330 CTGCAGAAGCATAATGGGCAAGG - Intergenic
1072904961 10:99444694-99444716 CTACAGAAAAAGAAGTGGCCTGG - Intergenic
1073009726 10:100349704-100349726 CCGCAGAGACAGAACAGGCCAGG + Intronic
1074331251 10:112511863-112511885 CTGCAGCAACAGGATGGAACTGG - Intronic
1075449865 10:122543781-122543803 CTGCAGAAACAGGATTGGGCTGG - Intergenic
1075715669 10:124553834-124553856 CTGCAGACAGAGGAGGGGCCTGG - Intronic
1076068395 10:127466876-127466898 CTGCAGAAACTCAGTGGCCCAGG + Intergenic
1076217657 10:128709598-128709620 CAGCTGAAACAGAGTTGGCCTGG - Intergenic
1076260326 10:129059953-129059975 CTGCAGTCACAGAATGTGGCAGG + Intergenic
1077026888 11:443895-443917 GTTCAGAAACAGAATGTGCAAGG + Intergenic
1078611055 11:12819965-12819987 GTGGAGAAACAGAATGGGCTGGG + Intronic
1078670092 11:13356933-13356955 CTGCAGACACACAAGGGGACTGG - Intronic
1079420656 11:20284446-20284468 CAGCAGTGACACAATGGGCCCGG + Intergenic
1079460784 11:20676073-20676095 TGGCAGAAACTGAATGGGCCAGG - Intronic
1080461516 11:32458883-32458905 CTGCAGAGCCATAATGAGCCTGG - Intergenic
1081032179 11:38098084-38098106 CTGCACAAACAGCAAGGCCCTGG + Intergenic
1081311606 11:41581185-41581207 CTGCAGAAACAAAATTAGCTGGG - Intergenic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1083951458 11:65958951-65958973 CTGCTGGAACAGGAAGGGCCGGG - Exonic
1084399883 11:68937347-68937369 CTGCAGCAGCAGGAGGGGCCTGG + Intronic
1087751353 11:102010937-102010959 CTGCAAAACCAGAAAGGCCCAGG + Intergenic
1089572451 11:119419521-119419543 CTGCAGAAAGAGAAGGGGGCCGG + Intronic
1090543849 11:127739730-127739752 CAGCAGAAAAAGATGGGGCCAGG + Intergenic
1090806688 11:130207092-130207114 CTGCAGAAACAAAATGTTCCAGG + Intronic
1091287173 11:134413861-134413883 GTGCAGAAGCAGGATGGGCGGGG + Intergenic
1091317894 11:134628289-134628311 ATGCAGAAACAGTATGGGGCAGG - Intergenic
1091727633 12:2856833-2856855 CAGCAGAAAATGTATGGGCCAGG + Intronic
1092222362 12:6723784-6723806 GAACAGACACAGAATGGGCCGGG + Exonic
1093280297 12:17186030-17186052 CTGCAGAAATAGAAATGGCTAGG + Intergenic
1095576081 12:43740950-43740972 CTGCAGTCACACAATTGGCCCGG - Intronic
1096305863 12:50474640-50474662 CAAAAGAAACAGAATGGGCCAGG - Intronic
1098211275 12:68168545-68168567 ATGCAGAAACAGAATGTCACCGG + Intergenic
1099423184 12:82489639-82489661 CAGCAGAAACATTATAGGCCAGG + Intergenic
1101594795 12:106154682-106154704 CTTCAGAGACTGAATGTGCCAGG - Intergenic
1102362828 12:112303137-112303159 CTGAAGAAACTGAATGACCCTGG - Intronic
1103557734 12:121776170-121776192 CAGCAGAAGCAGAGTGGCCCCGG - Exonic
1104529481 12:129555376-129555398 CTACAGAAACAGAATTACCCTGG + Intronic
1104701460 12:130907608-130907630 TTTAAGAAATAGAATGGGCCGGG - Intergenic
1105225806 13:18430470-18430492 CTGGGAAAACAGAATGGCCCTGG + Intergenic
1105923349 13:24984982-24985004 CTCCAGAGACAGAAAGGGCCTGG + Intergenic
1106602887 13:31202084-31202106 TTGCTGAAACAGAATGTGACAGG + Intronic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1108356562 13:49633729-49633751 CTGAAGAACCAGGATGGGACGGG + Exonic
1111185107 13:84724519-84724541 CTGAAGATTGAGAATGGGCCAGG - Intergenic
1111911413 13:94316420-94316442 ATAAAGAAACAGAATGGGCCGGG + Intronic
1112975527 13:105313321-105313343 TAGCAGAGACATAATGGGCCTGG - Intergenic
1113658584 13:112087560-112087582 CTACAGAACCAGAAAGGACCCGG - Intergenic
1113794925 13:113051294-113051316 CTTCAGAGACAGAAAGGCCCAGG - Intronic
1113866487 13:113529284-113529306 CTTAAGAAACAGAATCGGGCCGG + Intronic
1114583493 14:23787392-23787414 TTGCAGAAACAGAATGGAGCTGG - Intergenic
1114862273 14:26538855-26538877 CTTCAGAAAGAGAATGTGGCAGG - Intronic
1117124590 14:52608760-52608782 CAGCAGAAACATTACGGGCCAGG - Intronic
1117213473 14:53526087-53526109 CTGCAGAACCAGCATGAACCAGG + Intergenic
1118497138 14:66318184-66318206 CAGCAGAAACCTTATGGGCCAGG + Intergenic
1119371012 14:74143251-74143273 TGACAGAAACAGAATGAGCCTGG + Intronic
1119593408 14:75911321-75911343 CTGCATAACCAGACTGGGCGCGG - Intronic
1119662112 14:76459547-76459569 CTGCAGAGAGAGGGTGGGCCTGG + Intronic
1120841994 14:89094305-89094327 CAGCAGAAACAGAAGAGTCCTGG - Intergenic
1121463266 14:94098231-94098253 CTTCAGAGACAGCATGGCCCTGG - Intronic
1121493759 14:94378160-94378182 CTCCAGAAACAGATGGGCCCAGG + Exonic
1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG + Intergenic
1125106981 15:35983030-35983052 CTGCAGAAATAGGAAGGGTCAGG + Intergenic
1125883139 15:43210300-43210322 CTGGGGAACCAGAATGGGGCAGG - Intronic
1127717675 15:61665477-61665499 CTGCAGAATCTGAATGGGATGGG + Intergenic
1128486511 15:68095824-68095846 ATGAAGAAAAAGAATGGGCCAGG - Intronic
1129882554 15:79016860-79016882 CTGTAGAAACTGAAAGGGCAGGG - Intronic
1130294041 15:82630710-82630732 CTGGAGGGACAGAATGTGCCTGG + Intronic
1132005873 15:98226465-98226487 CTGGAGGGAAAGAATGGGCCCGG + Intergenic
1133346581 16:5075197-5075219 TAAAAGAAACAGAATGGGCCAGG - Intronic
1135180724 16:20271973-20271995 CTGCAGAGACATAATGAGTCAGG - Intergenic
1135298399 16:21302540-21302562 CTGCTGAAACAAAGTGGGGCAGG + Intronic
1135767645 16:25191691-25191713 CTACAGCAACAGGATGGGCATGG + Intergenic
1135956254 16:26958903-26958925 CTGCAGAGTCAGAAGGGTCCGGG + Intergenic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1138349136 16:56337274-56337296 CTGCTGAAGCAGCATGGGGCCGG + Intronic
1138608659 16:58105737-58105759 CTGCAGACAGAGGAGGGGCCAGG - Intergenic
1139558541 16:67727734-67727756 CTGCAGGTACAGGATGAGCCGGG - Exonic
1139686588 16:68608762-68608784 CTGCAGAATAAGAATGGACCAGG + Intergenic
1141113065 16:81286180-81286202 CTTAAGAAGCAAAATGGGCCAGG - Intronic
1141138228 16:81480575-81480597 CTGGAGCAGCAGAATGGGTCAGG - Intronic
1141290987 16:82717972-82717994 CTGCACACACAGAATGGGTCAGG - Intronic
1141295653 16:82766316-82766338 CTTCAGAAACAGTTTGGACCTGG - Intronic
1142124849 16:88405172-88405194 TTGCAGCCACAGGATGGGCCAGG + Intergenic
1143718046 17:8789514-8789536 GTCCACAAACAGAATGGGACAGG - Intergenic
1144191876 17:12853941-12853963 CTGCGGGAACAGAATGAGCTGGG - Intronic
1144452735 17:15394700-15394722 GTGCAGAAACAAAATTGGGCAGG - Intergenic
1144490869 17:15707700-15707722 CTGCAGCAAGAGTCTGGGCCTGG - Intronic
1146354864 17:32125464-32125486 CTGGAGAAGCAGCAGGGGCCTGG - Intergenic
1146370250 17:32261686-32261708 CTGCAGAGAGAGAAGGGGCTCGG + Intergenic
1147315575 17:39618548-39618570 ATGCAGAATGAAAATGGGCCAGG - Intergenic
1147729679 17:42590669-42590691 CTGAAAAAAAAGAATGCGCCAGG + Intronic
1148345455 17:46900543-46900565 CTCAAGAAATAGAAAGGGCCAGG - Intergenic
1150716814 17:67579216-67579238 CTGCCCAAACAGAAAGAGCCTGG - Intronic
1150913741 17:69414728-69414750 CTGCAGCTACATGATGGGCCAGG - Exonic
1152617674 17:81345450-81345472 CTGCAGGAACACTTTGGGCCGGG + Intergenic
1152678830 17:81655387-81655409 CTCCAGACACAGAGAGGGCCTGG - Intronic
1154527569 18:15309051-15309073 CTGGGAAAACAGAATGGCCCTGG - Intergenic
1155379692 18:25206307-25206329 CAGTAGATACAAAATGGGCCGGG - Intronic
1155720148 18:29001287-29001309 CTGCAGAGAAAGACTAGGCCAGG + Intergenic
1156442750 18:37207968-37207990 CTGCAAATACAGAATTAGCCAGG - Intronic
1157430320 18:47619407-47619429 CTGCAGAAACAACAAGGGCACGG - Intergenic
1160192353 18:76724401-76724423 CTGCAGAAAAAGAAACGGCTAGG - Intergenic
1160964288 19:1739216-1739238 ATGCAGAAACTGGATGGGCGTGG + Intergenic
1161132333 19:2598360-2598382 CTGAAAATACAGAATTGGCCGGG + Intronic
1161182451 19:2893425-2893447 CTGAAAATACAGAATTGGCCGGG + Intergenic
1161408214 19:4102242-4102264 CTGCAGAAAGAGAGTGGCCAAGG - Intronic
1161564077 19:4989988-4990010 CTTTAGAAACAGTTTGGGCCAGG + Intronic
1163067470 19:14809370-14809392 CTGCAGGAAGAGAGTGGCCCTGG + Intronic
1163125277 19:15241105-15241127 CTGCGGGGACAGGATGGGCCTGG - Intronic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1163745159 19:19042506-19042528 CTGCAAATACAGAAGAGGCCGGG - Intronic
1163748079 19:19059837-19059859 CTGCAGACCCAGTATGGCCCAGG + Intronic
1164713684 19:30376558-30376580 TTTCAGAAACAGAATGGGCCAGG + Intronic
1164914295 19:32038061-32038083 CAGCAGAGACAGAACGGGGCAGG + Intergenic
1167567718 19:50267274-50267296 CTGCAGAGCCAGAATGGAGCTGG + Intronic
1167719031 19:51165779-51165801 ATCTATAAACAGAATGGGCCAGG + Intergenic
1167899701 19:52610576-52610598 CTCAAAAACCAGAATGGGCCAGG - Intronic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
926113749 2:10198081-10198103 CCTGAGACACAGAATGGGCCTGG - Intronic
926198411 2:10777094-10777116 TTGCAGAGACAGAATGGGAAAGG + Intronic
926420163 2:12688003-12688025 CTCCAGAGTCAGAATGTGCCAGG - Intergenic
927284851 2:21346024-21346046 CTAGATACACAGAATGGGCCTGG + Intergenic
927593009 2:24373049-24373071 TTAAAGAAACAGAATGGGCCGGG + Intergenic
927997055 2:27494118-27494140 CTGCAGCGGCAGAATGGCCCCGG - Exonic
929397294 2:41537394-41537416 CTTGAAAAACAGAATAGGCCAGG - Intergenic
931551843 2:63454865-63454887 CAGCAGAAACCTTATGGGCCAGG + Intronic
933780242 2:85796033-85796055 CAGCTGAGGCAGAATGGGCCAGG - Intergenic
934654794 2:96111807-96111829 CAGCAGAAAGAGCCTGGGCCTGG + Intergenic
934929197 2:98406547-98406569 CAGCAGAAACATTATAGGCCAGG + Intergenic
938526665 2:132140508-132140530 CTGGGAAAACAGAATGGCCCTGG - Intergenic
939329160 2:140735871-140735893 CTGCACAACCAGAAAGGACCAGG + Intronic
939874128 2:147556970-147556992 CAGAAGGAACAGGATGGGCCAGG + Intergenic
940582745 2:155601529-155601551 CCACAGAAACAGCAGGGGCCAGG - Intergenic
941602291 2:167558514-167558536 CTCCAGAAGCAGAAGGGGTCAGG + Intergenic
942402083 2:175613331-175613353 CTAAAGAAACAGAATGTCCCTGG + Intergenic
942676217 2:178429140-178429162 CAGAAGAATGAGAATGGGCCAGG - Intergenic
943118120 2:183699022-183699044 CAGCAGAAACTTTATGGGCCAGG + Intergenic
948089303 2:235278997-235279019 CTGAAGAAATAAAATGGGCCAGG - Intergenic
948113948 2:235479813-235479835 CTGCAGAACCAGCATGGGGGTGG - Intergenic
1168959456 20:1858844-1858866 CTGAAGTTACAGAATGTGCCTGG + Intergenic
1169353487 20:4889085-4889107 CAGCAGAAACAGAAGGGCTCAGG - Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1171725447 20:28616117-28616139 CAGCAGAAACAATATGGACCAGG - Intergenic
1171752619 20:29066967-29066989 CAGCAGAAACAATATGGACCAGG + Intergenic
1171872504 20:30539716-30539738 ATGCACAAACAGAATTGGCTTGG - Intergenic
1171973715 20:31580519-31580541 CTGTAGAAACAGACTGTGCGGGG - Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172960526 20:38795948-38795970 CTGCTGAATCAGAATGGCCAAGG + Intergenic
1174197842 20:48786047-48786069 CAGCAGGAAGAGAATGGGGCTGG + Intronic
1175217103 20:57397095-57397117 CTGCAGAGACAGGCTGGGCCTGG - Intronic
1175515492 20:59567349-59567371 CTGCAGAAACACCCTGGGCTGGG + Intergenic
1176769861 21:13059493-13059515 CTGGGAAAACAGAATGGCCCTGG + Intergenic
1177229073 21:18295855-18295877 TTACAGAATCAGAATAGGCCGGG + Intronic
1178016393 21:28351233-28351255 CTGAAGAAACAGTGTGGGCACGG - Intergenic
1178288442 21:31345658-31345680 CTAAAGGAACAGAATGGGCACGG + Intronic
1179882830 21:44300534-44300556 CTTCAGAACCAGGAAGGGCCAGG - Intronic
1180390337 22:12275721-12275743 CAACAGAAACAATATGGGCCAGG - Intergenic
1180409404 22:12589034-12589056 CAGCAGAAACAATATGGGCCAGG + Intergenic
1180864984 22:19113074-19113096 CTAAAGAAACAGTATGGGCCAGG + Intronic
1181034793 22:20164738-20164760 CTGCTGAGACAGAAGGGGGCCGG - Intergenic
1181577784 22:23806624-23806646 CTTCAGAATCAGGATTGGCCAGG + Intronic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182676821 22:32045536-32045558 CTGCACAGGCAGAATGGTCCAGG + Intronic
1182676822 22:32045554-32045576 TTGAAGAAACACAATGGGCCTGG - Intronic
1183456045 22:37923927-37923949 ATGCACCCACAGAATGGGCCAGG - Intronic
1183554285 22:38513129-38513151 CTGCAGAAACAGCCTGGGCATGG + Intergenic
1184385417 22:44171564-44171586 CTGATGACACAGAATGGGCCAGG - Intronic
1184426500 22:44412012-44412034 GTGCAGAAAGAGCCTGGGCCGGG + Intergenic
949265399 3:2151398-2151420 CAGAAGGAACAGCATGGGCCAGG + Intronic
949609724 3:5692033-5692055 CTGGAGAAACAAAATGGCCCTGG - Intergenic
950262690 3:11554068-11554090 CTGCAGGGAATGAATGGGCCTGG + Intronic
950280440 3:11703179-11703201 ATGAGGAAACAGAATGGGCTTGG + Intronic
950574630 3:13824640-13824662 CTGCGGAGAGAGCATGGGCCTGG - Intronic
952026814 3:29092723-29092745 GTGCCAAAACAGAATGGGCCTGG - Intergenic
952235145 3:31471632-31471654 AGCCAGAAACAGAATGAGCCAGG + Intergenic
952482708 3:33778021-33778043 CTCCAGAAAAAGAATGAGCGGGG - Intergenic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953649705 3:44790974-44790996 ATTAAGAAACAGAAGGGGCCGGG - Intronic
954036060 3:47851879-47851901 CTGGAGAACAAGAAAGGGCCAGG - Exonic
954521744 3:51233657-51233679 CTGCTGAAAGAGGATGGGCGTGG - Intronic
955527557 3:59836869-59836891 CTGCAAAGGCAGAATGGCCCAGG + Intronic
956850916 3:73227707-73227729 CTGCAGAGACATAATGCCCCAGG - Intergenic
957499336 3:81033686-81033708 CTACACATAGAGAATGGGCCAGG - Intergenic
959563162 3:107805677-107805699 GAGCAGAAACAGAATGATCCTGG + Exonic
960123620 3:113973650-113973672 CAGCAGAAACGGTATAGGCCAGG - Intronic
961392034 3:126557959-126557981 CTGCAGCCACAGCCTGGGCCAGG + Intronic
961636281 3:128335038-128335060 CTGCAGGAACAGGGTGGTCCTGG - Intronic
961780746 3:129318878-129318900 CTGCAGCCACAGGCTGGGCCAGG + Intergenic
961782056 3:129326173-129326195 TTGCAGACACAGCCTGGGCCAGG - Intergenic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
961988116 3:131158683-131158705 CAGCAGAGACAGAATGGCTCAGG - Intronic
964456509 3:156873834-156873856 CAGCAGAAACTTTATGGGCCAGG - Intronic
966010026 3:175063776-175063798 TTCCAAAAACAGACTGGGCCGGG - Intronic
966937281 3:184719251-184719273 CTCCAGAGACATAAAGGGCCTGG + Intergenic
968844441 4:3032186-3032208 GTGAAAAAGCAGAATGGGCCGGG + Intronic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
971934566 4:33131469-33131491 CTACAAAAACAAAATGAGCCGGG + Intergenic
972600398 4:40566941-40566963 ATGAAGACACAGAATGGGCCGGG - Intronic
972919122 4:43916509-43916531 CTTCAGAAAAAAAATGGGCAAGG + Intergenic
974669789 4:65014682-65014704 CTGAACAACTAGAATGGGCCAGG + Intergenic
975337819 4:73200969-73200991 CTGCTTAAACAGTATGGGCGGGG + Intronic
977599777 4:98923605-98923627 CTCCAGAAAAAGAAAGGGGCTGG - Intronic
979261633 4:118654082-118654104 CTGGACAAACAGAATGTGCTGGG + Intergenic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
980629039 4:135410102-135410124 CTGCAGAAACCGCATCGTCCAGG - Intergenic
981217680 4:142190401-142190423 CTGCAGAAAAAGTATTGGCATGG + Intronic
982910715 4:161138669-161138691 CAACAGAAACCGAATGGGCCAGG + Intergenic
983267492 4:165522748-165522770 CTGCAGACACTGAATCTGCCAGG + Intergenic
983880215 4:172924164-172924186 CTGCTGAAAGAGAATGGGCCAGG - Intronic
984883347 4:184429264-184429286 CTGGAGACACAGGATGGTCCAGG + Intronic
988492896 5:31719950-31719972 CAGCAGAGGCAGAATTGGCCTGG + Intronic
990087089 5:51992472-51992494 CCATAGAAACAGAAAGGGCCGGG + Intergenic
992072048 5:73157269-73157291 CAACAGAAACAGAATGTGGCAGG + Intergenic
994151059 5:96448036-96448058 CTGCACAGCCAGAATGGCCCTGG - Intergenic
996963710 5:129282535-129282557 CTGCAGCAACATAATGGAGCTGG - Intergenic
997083293 5:130766065-130766087 CTAAAGAAATAGAATTGGCCGGG - Intergenic
997820844 5:137064261-137064283 CTGCATTAACAGAATTGACCTGG + Intronic
999374210 5:151075687-151075709 CTGCAGAGACAGAAGTGGGCTGG + Intronic
999667743 5:153931551-153931573 CAAGAGAAAAAGAATGGGCCGGG - Intergenic
999999336 5:157122307-157122329 CAGCAGAAACTTTATGGGCCAGG + Intronic
1001931965 5:175679501-175679523 GCACAGAATCAGAATGGGCCTGG + Intronic
1001997042 5:176170410-176170432 CAGCAGTACCAGAATGTGCCTGG - Intergenic
1002308579 5:178298750-178298772 CTAAAGGAGCAGAATGGGCCAGG + Intronic
1002617291 5:180463872-180463894 ATGCAGCAGCAGGATGGGCCTGG - Intergenic
1002707889 5:181175064-181175086 ATGCAAAAACAAAATTGGCCGGG + Intergenic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003315386 6:5007057-5007079 GAACAGAAACAGAATTGGCCGGG + Intergenic
1003418424 6:5934341-5934363 CTGCAGGAACACAGTGGGCAAGG - Intergenic
1004679009 6:17874223-17874245 CTGCAGAGACAGAAGGGGAAAGG - Intronic
1005806056 6:29475485-29475507 CTGCATACAAAGAAAGGGCCAGG + Intergenic
1007396053 6:41578483-41578505 CTGCAGCAACAGAGATGGCCTGG - Intronic
1007532923 6:42558909-42558931 CTCCAGAATCAGAATGGCACTGG + Intergenic
1008206093 6:48659151-48659173 GTGCAGAAACTGAGTGGGCAGGG - Intergenic
1008210926 6:48725134-48725156 CAGCAGAAACATAACAGGCCGGG - Intergenic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1009758981 6:67979229-67979251 CTGCAGAAACTGGATGAACCTGG - Intergenic
1011204855 6:84880705-84880727 CTGTAGAAACAATATGGCCCAGG - Intergenic
1011395804 6:86905750-86905772 ATGCAGAAAGAAAATGGGGCAGG - Intergenic
1012303560 6:97621056-97621078 CTAGAGAAACAGAATGGCCCAGG - Intergenic
1013705742 6:112832082-112832104 CTGCTGGCATAGAATGGGCCTGG + Intergenic
1015626455 6:135183725-135183747 CTGCAGGACCTGAAGGGGCCAGG - Intronic
1016644826 6:146394515-146394537 CTCCAGAAGCAGAAAGGGCATGG - Intronic
1016779560 6:147943114-147943136 ATGAAGCAATAGAATGGGCCAGG - Intergenic
1017613017 6:156211977-156211999 CTGCAGAAACCTTATGGGCCAGG - Intergenic
1018580331 6:165302460-165302482 CTGCAGCAGCACACTGGGCCGGG - Intronic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1019862452 7:3672245-3672267 CTACAGAAACAGGATGGGTATGG - Intronic
1020057175 7:5125900-5125922 CTGCAGAAAACGAAGGGGCTGGG - Intergenic
1020170736 7:5843004-5843026 CTGCAGAAAACGAAGGGGCTGGG + Intergenic
1022672718 7:32471457-32471479 CTGCAGGACGAGACTGGGCCGGG - Intergenic
1022762502 7:33370783-33370805 GTACAGAAACAGAAAGGGGCAGG - Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1023851012 7:44150402-44150424 CTACAGAGACAGAGAGGGCCAGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027265462 7:76492860-76492882 CTGCTAAAACAGAATGGGTGTGG - Intronic
1027298196 7:76800175-76800197 TAGCAGAACTAGAATGGGCCAGG + Intergenic
1027316833 7:76990977-76990999 CTGCTAAAACAGAATGGGTGTGG - Intergenic
1029624352 7:101710586-101710608 AAGCAGAAACAGGATGTGCCTGG + Intergenic
1032059536 7:128713008-128713030 CTAAAAAATCAGAATGGGCCGGG + Intronic
1032952039 7:136925671-136925693 CTGCAGAGACAGGAGGTGCCAGG - Intronic
1033809528 7:144994915-144994937 CTGCAGAAACAGAATCGGAAAGG + Intergenic
1033959621 7:146898256-146898278 CTGCTGTGACAGAATTGGCCAGG + Intronic
1034562386 7:151889465-151889487 CTGCAGAAGAAGTAGGGGCCAGG + Intergenic
1034717950 7:153261083-153261105 CCTCAGCAGCAGAATGGGCCAGG - Intergenic
1035719804 8:1783541-1783563 GTTGGGAAACAGAATGGGCCAGG + Exonic
1036207565 8:6816138-6816160 CTGCAGAATCATAAAGGCCCAGG + Intronic
1036990219 8:13584149-13584171 CAGCAGACCCAGAATGGCCCAGG - Intergenic
1037878517 8:22561312-22561334 CTGCAGGAGCAGAAGGGACCAGG - Intronic
1038724664 8:30069893-30069915 CTGCAGAAACTGAAGGAGTCTGG - Exonic
1038734554 8:30156849-30156871 CTCCAGAGACAGGAAGGGCCTGG - Intronic
1038753327 8:30316875-30316897 CTGCAGCAACAGATTAGGCTTGG + Intergenic
1039380443 8:37079941-37079963 CTGAAGAGTCAGAATGGGGCGGG + Intergenic
1039676439 8:39673151-39673173 CTGCAGAAACAAGATGATCCTGG + Intronic
1039746362 8:40431558-40431580 GTAAAGAAACAGAATCGGCCAGG + Intergenic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1041584976 8:59506060-59506082 CTGCAGAAAAAGCATGTGCTTGG + Intergenic
1042346312 8:67731654-67731676 CCACAGAAACAGAATAGTCCTGG - Intronic
1042451242 8:68949477-68949499 CAGCAGATAGAGAATGGGCTGGG + Intergenic
1042706738 8:71671284-71671306 CTGCAGAAACAGAGTGCCTCTGG - Intergenic
1042752315 8:72171276-72171298 TTAAAGAAACAGAATGGGCCTGG + Intergenic
1043608344 8:82030231-82030253 CTTAAAAAACAGAATAGGCCAGG - Intergenic
1044796713 8:95908396-95908418 CAGCAGAAACAAATTGGTCCTGG - Intergenic
1046070583 8:109248137-109248159 TTGAAGACACAGGATGGGCCCGG + Intronic
1048573292 8:135672242-135672264 CTGCAGAAACCAGATGAGCCAGG - Intergenic
1048879992 8:138864194-138864216 CTTTAGAAGGAGAATGGGCCAGG - Intronic
1050344014 9:4668443-4668465 CTGCAGAATTAGAAAGGACCAGG + Intergenic
1051212143 9:14756355-14756377 CTGCAGACACAAAATGTACCTGG + Exonic
1051365363 9:16317833-16317855 ATGCACACACAGAATGTGCCAGG - Intergenic
1051613633 9:18985698-18985720 CTGCCGGAACAGAAAGGGCAGGG - Intronic
1051630677 9:19137698-19137720 TTTCAGAAAGAGAAGGGGCCAGG - Intronic
1052246754 9:26346365-26346387 CTGCAGAAAAAAAAAGGGCTTGG + Intergenic
1052894200 9:33731958-33731980 CTGCACAAACAGAGCTGGCCAGG - Intergenic
1055662405 9:78518304-78518326 CAGAAGAGACAGAATGGGACTGG + Intergenic
1055799589 9:80020461-80020483 CTGTAGATACAAAATGGGCCAGG - Intergenic
1057208930 9:93189116-93189138 CAGCAGAAACAGGAAGGTCCGGG - Intronic
1059138885 9:111833541-111833563 ATGAAGCAACAGAATAGGCCGGG - Intergenic
1061919025 9:133772112-133772134 CAGCAAACACAGAATGAGCCTGG - Intronic
1062144177 9:134979665-134979687 CTGTGGAAACAGGAAGGGCCTGG + Intergenic
1062324282 9:136004863-136004885 GTGCAGAATCACAAAGGGCCGGG + Intergenic
1062450475 9:136613789-136613811 CTGCAGAAGCCAAATGGGCTTGG + Intergenic
1062679414 9:137770130-137770152 CTGAAGAAATAAAGTGGGCCGGG - Intronic
1203450971 Un_GL000219v1:116015-116037 CAGCAGAAACAATATGGACCAGG - Intergenic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1190051900 X:47156778-47156800 CTGCAGCAGCATGATGGGCCAGG - Intronic
1191194104 X:57703331-57703353 CTTCTGAACCAGAATGGGCTAGG + Intergenic
1192037368 X:67578779-67578801 GTGCATAGACAGAATGGGCTGGG + Intronic
1194333053 X:92609347-92609369 CTGCTGACACAGAATGGCACAGG - Intronic
1196916156 X:120537009-120537031 ATGCAGAATCAGAATGTTCCGGG - Exonic
1197549060 X:127865562-127865584 CAGCAGAAACATTATAGGCCAGG + Intergenic
1198283254 X:135163867-135163889 CAGCAGAAGCATAATAGGCCAGG + Intronic
1198287704 X:135208608-135208630 CAGCAGAAGCGGAATAGGCCAGG - Intergenic
1198832329 X:140764336-140764358 CTGCAGAGACGGAGTGGGGCGGG + Intergenic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200139899 X:153894941-153894963 CTTGAGAAACAGAGTGGGCCAGG - Intronic