ID: 1081702539

View in Genome Browser
Species Human (GRCh38)
Location 11:45161269-45161291
Sequence GATCCCACCTCCATGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081702531_1081702539 5 Left 1081702531 11:45161241-45161263 CCAGGGTGTCTTCTCTGAATGAG 0: 1
1: 0
2: 1
3: 22
4: 173
Right 1081702539 11:45161269-45161291 GATCCCACCTCCATGGGCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 233
1081702528_1081702539 22 Left 1081702528 11:45161224-45161246 CCAGTAATGTTACTTTCCCAGGG 0: 1
1: 0
2: 2
3: 14
4: 145
Right 1081702539 11:45161269-45161291 GATCCCACCTCCATGGGCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 233
1081702526_1081702539 23 Left 1081702526 11:45161223-45161245 CCCAGTAATGTTACTTTCCCAGG 0: 1
1: 0
2: 0
3: 25
4: 314
Right 1081702539 11:45161269-45161291 GATCCCACCTCCATGGGCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 233
1081702530_1081702539 6 Left 1081702530 11:45161240-45161262 CCCAGGGTGTCTTCTCTGAATGA 0: 1
1: 0
2: 1
3: 12
4: 177
Right 1081702539 11:45161269-45161291 GATCCCACCTCCATGGGCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081702539 Original CRISPR GATCCCACCTCCATGGGCTG GGG Intronic
900147505 1:1164872-1164894 GGTCCCACCTGCACAGGCTGGGG - Intergenic
901756539 1:11444758-11444780 CATCCCACCTGCCTGGGCAGAGG + Intergenic
902217573 1:14944443-14944465 CATCCCATCTCCAGGGGCCGTGG - Intronic
902389211 1:16092949-16092971 GGTCTCAGCTCCCTGGGCTGTGG + Intergenic
902531980 1:17096507-17096529 GATCCCACCTTCAAGGACTGAGG + Intronic
903294108 1:22332769-22332791 GCTCCCACCTGCAAGGGCAGAGG + Intergenic
905244260 1:36601968-36601990 GATCTCTCCTCCATGGGCACAGG - Intergenic
905297086 1:36961129-36961151 GAGCCTACCTCCATGTGCAGGGG - Intronic
906942658 1:50269121-50269143 GATCCTCCCTCCCTGTGCTGAGG - Intergenic
910384237 1:86664435-86664457 AATGCCTCCTCCATGGGCTCTGG - Intergenic
910384418 1:86665485-86665507 AATGCCTCCTCCATGGGCTCTGG + Intergenic
910521341 1:88125203-88125225 GAAGCCACATCCATGGGCTTTGG + Intergenic
912427728 1:109609514-109609536 GGTCCCACCTACTGGGGCTGAGG + Exonic
912562911 1:110563116-110563138 GATCCCACCAAGATGGTCTGGGG + Intergenic
915489070 1:156241558-156241580 GGCCCCACCTCCATTGGCTTTGG + Intronic
918967377 1:191369226-191369248 TGTCACTCCTCCATGGGCTGGGG - Intergenic
919725598 1:200880849-200880871 GGTCCCAGCTACTTGGGCTGAGG - Intergenic
919935052 1:202245737-202245759 GATCCCTCCCCCATGGGGAGAGG + Intronic
920689383 1:208134374-208134396 CCTCCCACCTCCCGGGGCTGTGG - Intronic
920702784 1:208230542-208230564 GATACCAGCTCCTTAGGCTGGGG + Intronic
922273912 1:224058884-224058906 AAAGCCACCTCCCTGGGCTGAGG - Intergenic
922421250 1:225462329-225462351 GTTCCCACCACCATGGGCCCTGG - Intergenic
922779188 1:228237902-228237924 GTTCACACCTGCATGGTCTGGGG + Intronic
1063388929 10:5635907-5635929 CACCCCGCCTCCACGGGCTGGGG + Intergenic
1066480979 10:35795242-35795264 CATCCCTCCTCCAAGGGCCGAGG + Intergenic
1066602951 10:37126792-37126814 GATCCCAACACTTTGGGCTGCGG + Intronic
1067076767 10:43191961-43191983 GATGCCAGCTTTATGGGCTGGGG + Intergenic
1067090923 10:43265567-43265589 GATCTCCCCTTCCTGGGCTGGGG + Intronic
1069595858 10:69669730-69669752 GAGGCCATCTCTATGGGCTGAGG - Intergenic
1069851755 10:71409779-71409801 GAGCCCAGTCCCATGGGCTGGGG + Intronic
1069912358 10:71767326-71767348 GGTCCCACCTCCAAAGGCTAGGG - Intronic
1071401795 10:85280314-85280336 GATCCCACCACCATGGAGTCTGG - Intergenic
1075672315 10:124270932-124270954 GAGCCCCCCTCCTGGGGCTGAGG + Intergenic
1076406558 10:130215867-130215889 GACACCACCTCCAGGGCCTGTGG - Intergenic
1076449139 10:130544227-130544249 GAGCACAGCTCCATGGGCAGAGG + Intergenic
1076716514 10:132366948-132366970 GATACAAACTCCTTGGGCTGAGG - Intronic
1081570201 11:44286082-44286104 GAGCCCAGCTCCAGGGCCTGGGG - Intronic
1081702539 11:45161269-45161291 GATCCCACCTCCATGGGCTGGGG + Intronic
1081858312 11:46317504-46317526 CATGCCAGCTCCCTGGGCTGAGG + Intronic
1081976716 11:47240021-47240043 GATCTCCTGTCCATGGGCTGGGG + Exonic
1084463173 11:69307557-69307579 TCTGCCACCTACATGGGCTGCGG - Intronic
1084961145 11:72717331-72717353 GTCCCCACCTCCCTGGACTGAGG - Intronic
1085298773 11:75446141-75446163 GCTCCCTGCTGCATGGGCTGGGG + Intronic
1086274453 11:85109162-85109184 GAGCCCACCTCTGTGGACTGGGG + Intronic
1092256608 12:6929287-6929309 GATCACAGCTCCAGGGGCAGCGG - Intronic
1093446715 12:19267842-19267864 AATCCCAGCTACTTGGGCTGAGG + Intronic
1095979576 12:47963785-47963807 GAGCCCGCCTCCTGGGGCTGGGG + Intronic
1097000821 12:55875012-55875034 AATCCCAGCTACTTGGGCTGAGG - Intergenic
1101831105 12:108257274-108257296 CACCCTGCCTCCATGGGCTGGGG - Intergenic
1101923140 12:108949384-108949406 AATCCCAGCTACTTGGGCTGAGG - Intronic
1102516349 12:113449427-113449449 GAACCCACCTCCAAGAGCTGAGG - Intergenic
1103739133 12:123079463-123079485 AATCCCAGCTACTTGGGCTGAGG - Intronic
1104120828 12:125798071-125798093 CATCCCACGTCCTAGGGCTGTGG + Intergenic
1104635650 12:130436750-130436772 GGGTCCCCCTCCATGGGCTGGGG + Intronic
1108594240 13:51936386-51936408 GAGTGCTCCTCCATGGGCTGAGG - Intronic
1112929441 13:104715659-104715681 GATCCCTCCTCAATGGCTTGTGG - Intergenic
1113697007 13:112354124-112354146 GACCCCACCTGGATGGGGTGGGG - Intergenic
1114412261 14:22512208-22512230 GAGACCACATCCATGGACTGTGG + Intergenic
1115603254 14:34976072-34976094 AATCCCAGCTACTTGGGCTGAGG + Intergenic
1116318042 14:43422994-43423016 AATCCCAGCTACTTGGGCTGAGG + Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1122855381 14:104557456-104557478 AATCCCACCTGGATTGGCTGGGG - Intronic
1123478844 15:20612669-20612691 GATTCCCCCTGCATGGCCTGGGG - Intergenic
1123639169 15:22387716-22387738 GATTCCCCCTGCATGGCCTGGGG + Intergenic
1124395113 15:29294157-29294179 AATCCCAGCTCCTGGGGCTGGGG - Intronic
1124964199 15:34421138-34421160 GCCCCCACTTCCTTGGGCTGTGG + Intronic
1124980812 15:34567366-34567388 GCCCCCACTTCCTTGGGCTGTGG + Intronic
1125723359 15:41855729-41855751 GATCCCGCCTCCAGGAGCTGGGG + Exonic
1126097677 15:45100817-45100839 GCTCCCACCCCCAGGGACTGGGG - Exonic
1126688006 15:51265209-51265231 GATCCCACCTCCCCTGGCTGCGG + Intronic
1129882896 15:79018819-79018841 GATCCCACCTCCCTGGGCCTAGG + Intronic
1131024693 15:89130306-89130328 GATGTCACCTCCATCAGCTGGGG - Intronic
1132580714 16:683529-683551 GACCCCACCTCCCTGGGCAATGG - Exonic
1133963066 16:10511146-10511168 GAACCCACCTCCATGGCATGTGG - Intergenic
1134826325 16:17287370-17287392 CCTCCCACCTCCTGGGGCTGTGG + Intronic
1135487739 16:22880641-22880663 GAGCCCATCTCCATGGGGGGAGG - Intronic
1137359178 16:47797522-47797544 CATCCCACCTCCCTGGGTGGTGG - Intergenic
1138139214 16:54552884-54552906 GATCTTAACTCCCTGGGCTGGGG - Intergenic
1138215985 16:55205970-55205992 GATGCTACCTCCATGTGATGAGG + Intergenic
1138270945 16:55695425-55695447 GCTCCCGCCTCAGTGGGCTGGGG - Intronic
1138389336 16:56658749-56658771 GAGGCCATCTCCATGGTCTGGGG + Intronic
1138451392 16:57095135-57095157 GATCCCACCTCCACTCCCTGAGG - Intronic
1139594123 16:67948297-67948319 GCTGCCACCTCCATGGCCTGAGG + Intronic
1139966330 16:70747567-70747589 GACCCCACCACCTCGGGCTGTGG - Intronic
1140078955 16:71726230-71726252 GGTTCAACCTCCATGGGCTAAGG + Intergenic
1142213989 16:88821967-88821989 GAACCCATCTCCCTGGGCTAGGG - Intronic
1142285537 16:89170057-89170079 AATCCCTCCTCCATGGGATGTGG - Intergenic
1142522815 17:517103-517125 CATAGCAACTCCATGGGCTGGGG + Exonic
1142957490 17:3531602-3531624 GAAGCCTCCTCCCTGGGCTGGGG + Intronic
1143373539 17:6454749-6454771 GACCCCACCCCCGAGGGCTGTGG + Exonic
1147705215 17:42421483-42421505 GATCCCGCCTCCCTGGGGTTAGG + Intronic
1147952510 17:44114977-44114999 GCTCCCACCTTCCTGGGCAGTGG + Intronic
1148644384 17:49210869-49210891 GGTCCCCCCTCCGGGGGCTGGGG - Intronic
1148892301 17:50817112-50817134 GATGCCAGCTCCTTGGGGTGTGG + Intergenic
1149975035 17:61256831-61256853 AATACCATCTGCATGGGCTGGGG - Intronic
1151493826 17:74447723-74447745 GAACCCCCCTCCAGTGGCTGTGG + Intronic
1151534466 17:74730826-74730848 GATCTCACCTCTGTGGTCTGTGG - Intronic
1151577301 17:74959156-74959178 GATCCCACCTCCAGAGCCAGAGG + Intronic
1151731029 17:75911178-75911200 GATCCTACCCCCTTGGCCTGCGG - Intronic
1151815061 17:76467717-76467739 GGTCCCACCTACCTGGACTGTGG - Intronic
1152271375 17:79326881-79326903 GGGCCCACCTCAGTGGGCTGTGG - Intronic
1154312917 18:13281553-13281575 TTTCCCACCTGCATGGGCAGTGG + Intronic
1157476307 18:48025659-48025681 GAGCCCTCAGCCATGGGCTGGGG + Intergenic
1158585843 18:58733894-58733916 GATCCCAACTCCATGGGTGTTGG - Intronic
1160273824 18:77411785-77411807 GATGCCAGCTTCATGGACTGAGG - Intergenic
1160508337 18:79439628-79439650 TCTCCCAGCTGCATGGGCTGCGG - Intronic
1161030153 19:2054255-2054277 GCTCCCACCTGCTGGGGCTGTGG - Intergenic
1161677297 19:5659024-5659046 AATCCCAGCTACTTGGGCTGAGG + Intronic
1161984201 19:7644897-7644919 GAACCCTCCTCCATTGGCTTGGG + Intronic
1162378887 19:10320766-10320788 GCTGCCACCTCCAGGGGCTGGGG + Exonic
1162547447 19:11339259-11339281 GAGTCCACCTGCATTGGCTGGGG - Intronic
1163645917 19:18489004-18489026 CATCCCACCTGCAGGGGGTGTGG + Intronic
1163706493 19:18817025-18817047 AATCCCAGCTACTTGGGCTGAGG + Intergenic
1164544183 19:29145422-29145444 GGTGCCACCTCCAAGGACTGGGG - Intergenic
1165453347 19:35897643-35897665 TATCTCACCTCCATGCCCTGGGG + Exonic
925072582 2:982881-982903 GATTCCCCCTCCTTGGGATGGGG - Intronic
925139416 2:1539731-1539753 GAAGCCACCTCCAGGGCCTGTGG + Intronic
926578477 2:14608802-14608824 CGTCCCACCTACTTGGGCTGAGG + Intergenic
926841685 2:17088131-17088153 GCTTCCACCTCCCTGGGCTCAGG - Intergenic
927366665 2:22304860-22304882 AGGCCCACCTCCATGAGCTGTGG - Intergenic
927722926 2:25398371-25398393 GATCCTAACGCCAAGGGCTGGGG - Intronic
928627939 2:33159995-33160017 GATCCCAGCTCGAGCGGCTGAGG - Intronic
932294560 2:70613544-70613566 GATCACACCTCCATGGGACAGGG - Intronic
934658777 2:96132161-96132183 GATACCACCACCATGGACTGGGG - Intronic
934896085 2:98121481-98121503 GAAGCCACCTCCATGGCCTGGGG - Intronic
935198591 2:100836283-100836305 GATCCCACCTCTCTGGGATGGGG - Intronic
935359838 2:102237936-102237958 GAGCCCACCCCCAAGGGCTAGGG - Intronic
936073932 2:109389851-109389873 GAGCCCACCTGCCTGGGCTGTGG + Intronic
937997296 2:127704000-127704022 GATCCCAGCTACTTGGGGTGGGG + Exonic
939884276 2:147664371-147664393 TACCCCACCTCCCTGGGCTCTGG - Intergenic
940301993 2:152185038-152185060 TGTCACTCCTCCATGGGCTGAGG + Intergenic
942211676 2:173677361-173677383 AATCCCACCTCCAGGGGCTGTGG + Intergenic
942331998 2:174836147-174836169 GACTCCCCCTCCATGTGCTGTGG + Intronic
944337004 2:198545921-198545943 GATTTCACCTCAATGTGCTGAGG + Intronic
944724166 2:202452878-202452900 GATCCCGCCTCAGTGGTCTGGGG + Intronic
944865620 2:203858472-203858494 GACACATCCTCCATGGGCTGAGG - Intergenic
946942180 2:224780950-224780972 CATCCCTCCTCCTTGGGCTGTGG + Intronic
948411883 2:237769756-237769778 GACCCAACCTCCTTTGGCTGTGG + Intronic
948825697 2:240572636-240572658 GCTCCTACCTGCCTGGGCTGTGG + Intronic
948892786 2:240915447-240915469 GATCCCAGGGCCAGGGGCTGAGG - Intergenic
1169131303 20:3167589-3167611 TATCCCAACCTCATGGGCTGGGG + Intronic
1169527415 20:6445146-6445168 GTTCCCAAGTCCCTGGGCTGTGG + Intergenic
1172122284 20:32605552-32605574 GAACCCACCTCGCTGGGCTGAGG + Intronic
1173791961 20:45833857-45833879 CGGCCGACCTCCATGGGCTGCGG + Exonic
1174530680 20:51211113-51211135 GCTCCAACCTCCTTGGGCTCAGG + Intergenic
1175312066 20:58018984-58019006 GTTCCCAGCTCCACTGGCTGGGG - Intergenic
1175737723 20:61398947-61398969 CATCACACCTCCATGGCCAGAGG - Intronic
1175989529 20:62780947-62780969 GGCCGCACCTCCATGGGCGGAGG - Intergenic
1176179506 20:63742726-63742748 GCTCCGACCTCCGTGGGCTGCGG - Exonic
1179959083 21:44758321-44758343 GGTGCCACCTCCCTGGCCTGTGG + Intergenic
1181012687 22:20051732-20051754 GGTCCCAGCTACTTGGGCTGAGG + Intronic
1181523213 22:23460962-23460984 CCCCCCACCACCATGGGCTGAGG + Intergenic
1181560180 22:23695482-23695504 CAGCACACCTCCATGGGCAGGGG + Intronic
1182083349 22:27544289-27544311 AATCTGACCTCCATGGGCTGGGG + Intergenic
1182114625 22:27748964-27748986 TTTCCCCCCACCATGGGCTGTGG - Exonic
1183212238 22:36458156-36458178 GGCCCCACCCCCAGGGGCTGTGG - Intergenic
1184257881 22:43297296-43297318 AATCCCTTCTCCATGGGCAGTGG + Intronic
1184583154 22:45430508-45430530 GATGCCACCTCCATGAGCCATGG - Intronic
1185303100 22:50093967-50093989 AATCCCACCTGCATGTGATGTGG + Intronic
950462537 3:13134086-13134108 GACCACACCTCCATTTGCTGAGG + Intergenic
950842584 3:15981747-15981769 GCTCCCTTTTCCATGGGCTGTGG - Intergenic
953732093 3:45458569-45458591 AATCCCAGCTACTTGGGCTGAGG + Intronic
953968936 3:47332238-47332260 AATCCCAGCTACTTGGGCTGAGG + Intronic
954876576 3:53806361-53806383 CATCCCACCTAGAGGGGCTGGGG + Intronic
955366380 3:58313776-58313798 GATCACACCTCCATGGCTGGGGG + Intronic
960055213 3:113272312-113272334 GATCCCATCTCCATGCTCTCTGG + Intronic
960635733 3:119782639-119782661 AATACCACCTCCAAGGACTGTGG + Intronic
961550420 3:127667766-127667788 CAGCCCAGCTCCAGGGGCTGCGG + Intronic
961816531 3:129553503-129553525 CATCTCACGTCCATGAGCTGGGG + Intergenic
964904865 3:161707525-161707547 GATTCCTCCTCTATGGGCAGGGG + Intergenic
968459737 4:718616-718638 GACCCCACCTCCGTGGACCGTGG - Intronic
968682441 4:1930239-1930261 GAGCCCACCTCCATGTTCAGGGG + Intronic
968875137 4:3262722-3262744 GGTCCCACTTCCCTGAGCTGAGG - Intronic
968880657 4:3297341-3297363 GATCCCGCCTCTGGGGGCTGCGG - Intronic
969183701 4:5460469-5460491 AATCCCACCTCCAGGTGCTCAGG + Intronic
969627087 4:8311175-8311197 GACCCCTCCTCCCTGGGCTCTGG + Intergenic
970431700 4:15994837-15994859 GATCACACCTCCTAGGGATGTGG - Intronic
972710753 4:41592087-41592109 GATAGCACTGCCATGGGCTGAGG + Intronic
978315252 4:107428424-107428446 ATGCCCACCTGCATGGGCTGTGG - Intergenic
982657155 4:158164038-158164060 GAGCCCACCTCCTTGAGCTTGGG + Intronic
982868246 4:160544300-160544322 AATCCCATCTCCAGAGGCTGAGG - Intergenic
984323278 4:178221693-178221715 GACACCACCTCCATAGGTTGAGG - Intergenic
984358270 4:178693406-178693428 AGTCCCAGCTACATGGGCTGAGG - Intergenic
984944004 4:184957034-184957056 CCTCCCACTTCCATGGCCTGTGG - Intergenic
985345814 4:189002654-189002676 GAGCCCACCTCCAGGGCCTTGGG - Intergenic
985487840 5:161975-161997 GATCCCGGCTCCTTAGGCTGTGG + Intronic
986123759 5:4866943-4866965 GACCCCTCCACCGTGGGCTGTGG - Intergenic
987045461 5:14103449-14103471 TGTCCCTCCCCCATGGGCTGGGG - Intergenic
992591728 5:78302538-78302560 AATCCCAGCTCCAGAGGCTGAGG + Intergenic
994603973 5:101943234-101943256 GCTCACACATTCATGGGCTGTGG + Intergenic
998166460 5:139847235-139847257 GCTGCCACCTCCCTGGGCTCAGG + Intronic
998476547 5:142427075-142427097 TATCCCCTCTCCAGGGGCTGCGG + Intergenic
998618839 5:143772170-143772192 TAACCCACATCCTTGGGCTGAGG + Intergenic
1001562079 5:172676479-172676501 GAACCCATCTCCATGGCCAGGGG + Intronic
1002399603 5:178984261-178984283 GCTCCCCACTCCACGGGCTGCGG - Intronic
1002588225 5:180266701-180266723 AATCCCAGCTACTTGGGCTGAGG - Intronic
1002777690 6:342714-342736 GCTCCCAGCTCCATGGCCGGAGG + Intronic
1003305172 6:4920732-4920754 AATCCCACCTCCAGAGGCGGAGG - Intronic
1004439234 6:15631738-15631760 CATCCAACCTGCAGGGGCTGGGG - Intronic
1005159534 6:22843136-22843158 GATCCCACCTCCAAGTACTTTGG + Intergenic
1006340453 6:33443689-33443711 GCTCCCACCTCCAGGCCCTGAGG - Exonic
1006656553 6:35598850-35598872 AATCCCAGCTACTTGGGCTGAGG + Intronic
1006913440 6:37579040-37579062 CATCCTACCTCCCTGGGGTGAGG + Intergenic
1007765841 6:44159299-44159321 GATCTCATCTTCCTGGGCTGAGG - Intronic
1007841773 6:44722379-44722401 GATCTCACATCCATGTGCTTAGG + Intergenic
1008430714 6:51413494-51413516 GATCCCCCCTCCATGATGTGTGG - Intergenic
1008687347 6:53940440-53940462 GGTGACACCCCCATGGGCTGGGG - Intronic
1008897230 6:56570228-56570250 CATCCCCCCTCCCTGGCCTGTGG - Intronic
1015776936 6:136823524-136823546 GATCTCAGCTCACTGGGCTGGGG - Intronic
1017023176 6:150157983-150158005 CCTCCCACCTTCCTGGGCTGGGG + Intronic
1017044545 6:150334812-150334834 GATCCCACAGCCAAGGCCTGGGG + Intergenic
1018342734 6:162868596-162868618 GATCTCACCTGCATGGGGCGGGG - Intronic
1018950779 6:168377501-168377523 GACCCCACCTCCAAGGCCAGGGG - Intergenic
1019588117 7:1815595-1815617 CTCCCCACCACCATGGGCTGAGG - Intergenic
1019735121 7:2646727-2646749 GGGCCCACCTCCCAGGGCTGGGG + Intronic
1021738148 7:23659108-23659130 GGTCACTCCCCCATGGGCTGGGG - Intergenic
1023255892 7:38311665-38311687 GACCCCATCTGCAGGGGCTGGGG - Intergenic
1024655601 7:51449030-51449052 AATCCCAGCTACTTGGGCTGAGG - Intergenic
1026478420 7:70757898-70757920 GATCCCAGCTACTTGGGCGGAGG - Intronic
1033879941 7:145868961-145868983 AAACCCACCTGCATGGCCTGGGG - Intergenic
1035106034 7:156442054-156442076 GCTCCCACCTCCAAGAGCTGAGG + Intergenic
1036792975 8:11735500-11735522 GATCCCATCTCCAGGGGCAGAGG - Intronic
1037286789 8:17310114-17310136 GGTCCCAGCTACTTGGGCTGAGG - Intronic
1037625977 8:20607565-20607587 GATCCCAACCCCACGGGCTAGGG - Intergenic
1040572940 8:48625600-48625622 GATCCCATTTCCCTTGGCTGAGG + Intergenic
1043926302 8:86040829-86040851 CATCCCACCTCCATGTGGAGGGG + Intronic
1047209455 8:122829627-122829649 GGTCCCACCTTCAAGTGCTGAGG + Intronic
1048399508 8:134051255-134051277 CACCCCACCTCCATGGACTAGGG - Intergenic
1048719357 8:137305283-137305305 GAACCCCCTCCCATGGGCTGAGG - Intergenic
1049306698 8:141907825-141907847 GTCCCCACCTCCCTGGCCTGAGG - Intergenic
1051733286 9:20170408-20170430 TGTCCCTCCCCCATGGGCTGGGG + Intergenic
1054906773 9:70419712-70419734 CACCCCAACTCCATGGGCTGCGG + Intergenic
1055609324 9:78005162-78005184 GGTCCCAGCTACATGGGGTGTGG - Intronic
1055793335 9:79947105-79947127 GGCCCAAGCTCCATGGGCTGAGG - Intergenic
1056533736 9:87509852-87509874 GAGGCCTCCTCCATGTGCTGTGG - Intronic
1056664344 9:88569442-88569464 GATGGCACCTCCATGTGCTTGGG - Intronic
1056779068 9:89535822-89535844 GGCACCACCTCCAGGGGCTGAGG + Intergenic
1057407065 9:94782072-94782094 AATCCCAGCTACTTGGGCTGAGG + Intronic
1057435962 9:95040697-95040719 GGTCCCACCTCCAGGAGCTTGGG - Intronic
1057517108 9:95731130-95731152 GATCCCAAATCCATGGCATGAGG + Intergenic
1059330282 9:113530766-113530788 GATCTGATCTCCAGGGGCTGTGG + Intronic
1059611614 9:115903300-115903322 GGACCCACCTCCAGAGGCTGCGG + Intergenic
1061893475 9:133634907-133634929 GACCTCACCTGCCTGGGCTGTGG + Intergenic
1062002246 9:134222190-134222212 GATCCAACCTGCAGGGGCTGGGG - Intergenic
1062308238 9:135921568-135921590 GTTCCCACCTCCGTGGGGGGAGG + Intergenic
1062573880 9:137197740-137197762 GACCCCACCTTGATGGGCTGGGG + Intronic
1187179336 X:16929005-16929027 AGTCCCAGCTACATGGGCTGAGG + Intergenic
1190166910 X:48080695-48080717 GATCCCACAACCATGCGCTCAGG - Intergenic
1192497128 X:71623344-71623366 GAACTCACCCTCATGGGCTGGGG - Intergenic
1194729731 X:97439452-97439474 AATCCCAGCTACTTGGGCTGAGG + Intronic
1195885680 X:109635149-109635171 GATCCCATCTCCTCGGGTTGTGG - Intronic
1196746206 X:119073422-119073444 GTTCCCACCCCCGGGGGCTGCGG - Intergenic
1197243588 X:124145823-124145845 TGTCACTCCTCCATGGGCTGCGG - Intronic
1198636715 X:138710356-138710378 GCTTCCACCTCCAAGGGATGTGG - Intronic
1199584241 X:149396394-149396416 TGTCCCTCCCCCATGGGCTGGGG - Intergenic
1200068554 X:153516905-153516927 CTTCCCAGCTCCAGGGGCTGTGG - Intergenic
1200155556 X:153972872-153972894 GGACCCACCTCCCAGGGCTGCGG - Intronic