ID: 1081702627

View in Genome Browser
Species Human (GRCh38)
Location 11:45161630-45161652
Sequence GAGCCGTCCCGGGACTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081702627_1081702640 24 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702640 11:45161677-45161699 CAGGGTTGGCCTCGCAGCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 248
1081702627_1081702634 0 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702634 11:45161653-45161675 TGGGCCACACTGGCTGATCCAGG 0: 1
1: 0
2: 0
3: 21
4: 222
1081702627_1081702633 -10 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702633 11:45161643-45161665 GGGACGGCTCTGGGCCACACTGG 0: 1
1: 0
2: 2
3: 14
4: 208
1081702627_1081702636 5 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702636 11:45161658-45161680 CACACTGGCTGATCCAGGTCAGG 0: 1
1: 0
2: 1
3: 12
4: 123
1081702627_1081702641 25 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702641 11:45161678-45161700 AGGGTTGGCCTCGCAGCCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 204
1081702627_1081702643 27 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702643 11:45161680-45161702 GGTTGGCCTCGCAGCCCCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 129
1081702627_1081702637 6 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702637 11:45161659-45161681 ACACTGGCTGATCCAGGTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 160
1081702627_1081702638 10 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702638 11:45161663-45161685 TGGCTGATCCAGGTCAGGGTTGG 0: 1
1: 0
2: 1
3: 24
4: 189
1081702627_1081702642 26 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702642 11:45161679-45161701 GGGTTGGCCTCGCAGCCCCGGGG 0: 1
1: 0
2: 0
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081702627 Original CRISPR GAGCCGTCCCGGGACTCTCA GGG (reversed) Intronic
903860515 1:26361677-26361699 GAGCAGTGCCGGGACTCCCCTGG - Exonic
909081530 1:71118304-71118326 GAGCCCTCCATGGACTCTCTTGG + Intergenic
910047415 1:82934111-82934133 GAGCCATCCCTGGACTCTGAAGG + Intergenic
1070528574 10:77316470-77316492 GAGCCTGCACGGGACTCTCCTGG + Intronic
1080330740 11:31134387-31134409 GAGGAGTCCTGTGACTCTCAGGG - Intronic
1081702627 11:45161630-45161652 GAGCCGTCCCGGGACTCTCAGGG - Intronic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1091410344 12:235049-235071 GAGCCCTCACGTGACTCCCAGGG - Intronic
1092282407 12:7108264-7108286 GAGCCGTCCCAGGACTGTGCAGG - Exonic
1096974770 12:55693771-55693793 GAAGCTTCCCTGGACTCTCATGG + Intronic
1097029053 12:56079102-56079124 GATCCGTCCCGGGACTAGCAGGG + Intergenic
1104159318 12:126163367-126163389 GACCTGTCTCAGGACTCTCAGGG + Intergenic
1114069859 14:19098007-19098029 GAGCGCTCCCGGGAGTCTCCTGG - Intergenic
1114092403 14:19301995-19302017 GAGCGCTCCCGGGAGTCTCCTGG + Intergenic
1121656000 14:95596133-95596155 GAGGTGTCCCGTGTCTCTCAGGG + Intergenic
1122517546 14:102319487-102319509 GAGCTGTCCCGGATCTCCCAGGG - Intronic
1122830860 14:104394925-104394947 GAGCCTTCCTGGGACCCTCCAGG - Intergenic
1124427169 15:29571335-29571357 GAGCCGTCCCCAGGCTCTGAAGG - Intergenic
1132384098 15:101387702-101387724 GGGCCCTCCCCAGACTCTCAGGG + Intronic
1132953861 16:2580674-2580696 GAGCTGTGCCTGGACCCTCACGG - Intronic
1132960484 16:2619489-2619511 GAGCTGTGCCTGGACCCTCACGG + Intergenic
1133328477 16:4956840-4956862 CAGCCCTCCCAGGACTCCCAGGG - Intronic
1141632015 16:85293127-85293149 AAGCCGATCCGTGACTCTCAGGG - Intergenic
1145761236 17:27426348-27426370 GAGGGGTCCGGTGACTCTCATGG + Intergenic
1152333604 17:79687119-79687141 GAGCCCTCCAGGGGTTCTCAAGG + Intergenic
1155972279 18:32093033-32093055 AGGCCGCCCCGGGACTCTGAGGG - Intronic
1156822498 18:41389857-41389879 GACCCTTCCCTGGACTCTCTGGG + Intergenic
1160505829 18:79426495-79426517 GACCCGTGTCGGGACTCGCAGGG + Intronic
1160853594 19:1206163-1206185 GAGCCGGCCCGCGACCCCCAAGG - Intronic
1160870411 19:1275309-1275331 GCGCCTTGCCGGGACTCCCACGG + Intergenic
1162070607 19:8149873-8149895 GAGAAGTCCCGGGACTCACCTGG + Intronic
1165952270 19:39481030-39481052 GAGGCGTCCCGGAACCCCCAAGG - Intronic
1167971945 19:53193208-53193230 GAGCCGTGCGGGGACTTTAAGGG + Intronic
925152719 2:1626382-1626404 GAGCCTTCCCGGCAAGCTCAGGG + Intergenic
925399298 2:3560268-3560290 GAGCCTTCCCGGGCATCTCTGGG - Intergenic
927316462 2:21688908-21688930 GAGCCGTTAAGGTACTCTCAGGG - Intergenic
931747363 2:65301758-65301780 GAGACTTCCCGGGAATCTGAAGG - Intergenic
933754056 2:85623824-85623846 GAGCCATCCCAGGGCTCCCAGGG + Intronic
941812657 2:169768998-169769020 GAGGCGTGCCTGGGCTCTCAGGG + Intronic
942940254 2:181607239-181607261 GTGCGGTCCAGGGACTCTCAGGG - Intronic
943666876 2:190618324-190618346 TAGCAGTTCCTGGACTCTCAAGG + Intergenic
1169389561 20:5178689-5178711 GAGCTGTCCCGGGGGACTCAAGG + Intronic
1170446887 20:16437526-16437548 TACCTGTCCCGTGACTCTCAAGG - Intronic
1170759053 20:19233430-19233452 GAGCCATCACGGGACACTTATGG - Intronic
1175940056 20:62533693-62533715 AAGCGATCCCGGGGCTCTCATGG + Intergenic
1179647981 21:42786860-42786882 GAGCTATCCCAGGCCTCTCAGGG - Intergenic
1180023725 21:45146444-45146466 CAGCCGGACCGGGACTCTCCCGG + Intronic
1180488325 22:15820571-15820593 GAGCGCTCCCGGGAGTCTCCTGG - Intergenic
1180967956 22:19800329-19800351 GAGCCCTCCGGGGGCTCTCAGGG + Intronic
1182476314 22:30578545-30578567 GAGCCTTCCCGGCAGACTCAAGG - Intronic
1183936430 22:41265045-41265067 GAGCCTTCCCGGGCCACTCCAGG - Intronic
950656698 3:14441123-14441145 GGGCAGAGCCGGGACTCTCAGGG + Intronic
951718565 3:25674292-25674314 GAGGCATCCCTGTACTCTCAGGG - Intergenic
971196235 4:24473165-24473187 CTGCCGTCCCGGGACGCGCATGG - Intergenic
975327968 4:73081445-73081467 GGCCCATCCAGGGACTCTCATGG - Intronic
986013799 5:3740428-3740450 GAGCCTCCCTGGGACACTCAAGG - Intergenic
990446749 5:55900187-55900209 GAGCAGTCCCTGTGCTCTCAAGG + Intronic
993924257 5:93846117-93846139 GAGGTCTCCCAGGACTCTCATGG - Intronic
1001552820 5:172616976-172616998 GAGCAGCCCTGGGTCTCTCAGGG - Intergenic
1001772222 5:174305156-174305178 GACCCCTCCTGGGACTTTCATGG - Intergenic
1002710267 5:181190926-181190948 GAGCCGTCCCGAGACCCCCAGGG + Intergenic
1003729376 6:8804072-8804094 GAGCCATCCCTGAACCCTCATGG + Intergenic
1006932459 6:37696454-37696476 GAGCCGACCGGGTGCTCTCAAGG + Intronic
1009558258 6:65203053-65203075 GGGCAGTGCCTGGACTCTCAGGG - Intronic
1019431186 7:1000613-1000635 GAGGCGTCCCCGATCTCTCAGGG - Intronic
1034466957 7:151235436-151235458 GAGCAGGCCCGGTACTGTCATGG + Exonic
1035074744 7:156169977-156169999 GAGCCGTCCTGGGACCCGCCAGG + Intergenic
1035231416 7:157468274-157468296 GGGCCGTCCCCGGCCTCACACGG - Intergenic
1040307077 8:46217648-46217670 GAGCCAGCCCGGGACTATCCTGG + Intergenic
1040582503 8:48708885-48708907 GAGCTGCCCCGGGACTGGCAGGG + Intergenic
1053166276 9:35846251-35846273 AAGCCGGCCAGGGACTCTGAAGG - Exonic
1053481940 9:38422613-38422635 GACCCGTCCAGGGCCACTCAGGG + Intronic
1057197040 9:93121033-93121055 GACCAGGCCCTGGACTCTCAGGG - Intergenic
1057528583 9:95824203-95824225 GAGTCCTCCCGGGAGCCTCATGG + Intergenic
1061793053 9:133068596-133068618 GAGCCGCCCCTTGCCTCTCAGGG - Intronic
1061795658 9:133084380-133084402 GAGCCGCCCCTTGCCTCTCAGGG - Intronic
1061842881 9:133369911-133369933 GAGCCGTGGTGGGACTCCCAGGG + Intronic
1062262953 9:135671914-135671936 GAGCCTTCACGGGAGTCTGAAGG + Intergenic
1185726399 X:2425535-2425557 GAGCCTGCCAGGGACTCACAGGG - Intronic