ID: 1081702627

View in Genome Browser
Species Human (GRCh38)
Location 11:45161630-45161652
Sequence GAGCCGTCCCGGGACTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081702627_1081702643 27 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702643 11:45161680-45161702 GGTTGGCCTCGCAGCCCCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 129
1081702627_1081702640 24 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702640 11:45161677-45161699 CAGGGTTGGCCTCGCAGCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 248
1081702627_1081702641 25 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702641 11:45161678-45161700 AGGGTTGGCCTCGCAGCCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 204
1081702627_1081702638 10 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702638 11:45161663-45161685 TGGCTGATCCAGGTCAGGGTTGG 0: 1
1: 0
2: 1
3: 24
4: 189
1081702627_1081702637 6 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702637 11:45161659-45161681 ACACTGGCTGATCCAGGTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 160
1081702627_1081702642 26 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702642 11:45161679-45161701 GGGTTGGCCTCGCAGCCCCGGGG 0: 1
1: 0
2: 0
3: 13
4: 160
1081702627_1081702636 5 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702636 11:45161658-45161680 CACACTGGCTGATCCAGGTCAGG 0: 1
1: 0
2: 1
3: 12
4: 123
1081702627_1081702634 0 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702634 11:45161653-45161675 TGGGCCACACTGGCTGATCCAGG 0: 1
1: 0
2: 0
3: 21
4: 222
1081702627_1081702633 -10 Left 1081702627 11:45161630-45161652 CCCTGAGAGTCCCGGGACGGCTC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081702633 11:45161643-45161665 GGGACGGCTCTGGGCCACACTGG 0: 1
1: 0
2: 2
3: 14
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081702627 Original CRISPR GAGCCGTCCCGGGACTCTCA GGG (reversed) Intronic