ID: 1081708458

View in Genome Browser
Species Human (GRCh38)
Location 11:45200719-45200741
Sequence AGTCTGCAGGGACCCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 211}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081708458_1081708465 5 Left 1081708458 11:45200719-45200741 CCAGGGGAGGGTCCCTGCAGACT 0: 1
1: 0
2: 2
3: 17
4: 211
Right 1081708465 11:45200747-45200769 ATCACTTGGGGAAACTGCCATGG 0: 1
1: 0
2: 0
3: 13
4: 214
1081708458_1081708468 11 Left 1081708458 11:45200719-45200741 CCAGGGGAGGGTCCCTGCAGACT 0: 1
1: 0
2: 2
3: 17
4: 211
Right 1081708468 11:45200753-45200775 TGGGGAAACTGCCATGGAAGGGG 0: 1
1: 0
2: 3
3: 40
4: 322
1081708458_1081708467 10 Left 1081708458 11:45200719-45200741 CCAGGGGAGGGTCCCTGCAGACT 0: 1
1: 0
2: 2
3: 17
4: 211
Right 1081708467 11:45200752-45200774 TTGGGGAAACTGCCATGGAAGGG 0: 1
1: 1
2: 2
3: 24
4: 253
1081708458_1081708466 9 Left 1081708458 11:45200719-45200741 CCAGGGGAGGGTCCCTGCAGACT 0: 1
1: 0
2: 2
3: 17
4: 211
Right 1081708466 11:45200751-45200773 CTTGGGGAAACTGCCATGGAAGG 0: 1
1: 1
2: 1
3: 22
4: 245
1081708458_1081708462 -9 Left 1081708458 11:45200719-45200741 CCAGGGGAGGGTCCCTGCAGACT 0: 1
1: 0
2: 2
3: 17
4: 211
Right 1081708462 11:45200733-45200755 CTGCAGACTGGAGCATCACTTGG 0: 1
1: 0
2: 2
3: 14
4: 134
1081708458_1081708464 -7 Left 1081708458 11:45200719-45200741 CCAGGGGAGGGTCCCTGCAGACT 0: 1
1: 0
2: 2
3: 17
4: 211
Right 1081708464 11:45200735-45200757 GCAGACTGGAGCATCACTTGGGG 0: 1
1: 0
2: 2
3: 97
4: 1390
1081708458_1081708463 -8 Left 1081708458 11:45200719-45200741 CCAGGGGAGGGTCCCTGCAGACT 0: 1
1: 0
2: 2
3: 17
4: 211
Right 1081708463 11:45200734-45200756 TGCAGACTGGAGCATCACTTGGG 0: 1
1: 0
2: 1
3: 16
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081708458 Original CRISPR AGTCTGCAGGGACCCTCCCC TGG (reversed) Intronic
900707388 1:4089179-4089201 AGGCAGCAGGGACCCTCCCCAGG - Intergenic
901455053 1:9358395-9358417 AGCCAGCAGGTAGCCTCCCCGGG + Intronic
902785483 1:18730411-18730433 AGGCTGCAGGGACCATCGGCAGG - Intronic
903216445 1:21846089-21846111 CCACTGCAGGGACCCTCACCGGG + Exonic
903789244 1:25881396-25881418 ACCCTGCAGGGACCACCCCCAGG + Intergenic
904036800 1:27563459-27563481 AGTCTGCAGGGAGGATTCCCAGG - Intronic
904039088 1:27574155-27574177 AGCCTGCCTGGACCATCCCCTGG + Intronic
904238252 1:29127735-29127757 TCTTTGGAGGGACCCTCCCCAGG + Intergenic
905203211 1:36327804-36327826 AGGTTTCAGGGACCTTCCCCAGG - Exonic
905363693 1:37437298-37437320 AGTCACCAGGGGCCCTCCCCTGG - Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
912370288 1:109168498-109168520 AGCCTTCAGGGATCCTCCCATGG + Intronic
918090530 1:181290010-181290032 ATCCTGCAGGGCCTCTCCCCAGG + Intergenic
919769976 1:201151875-201151897 AGTATGCAGAGACCCTGCCTGGG + Intronic
920306019 1:205018607-205018629 AGCTTGGAGGGCCCCTCCCCTGG + Exonic
923652022 1:235883022-235883044 AGTCTGCAGGGGCCAGCTCCTGG + Intronic
923766231 1:236894613-236894635 AGTCTTCAGGCACCCACCCCAGG - Intronic
924101502 1:240607586-240607608 TGTCTGGAGGCACCATCCCCTGG - Intronic
924706475 1:246506883-246506905 TGTCAGCAGCGACCCGCCCCCGG + Intronic
1063374457 10:5545800-5545822 AGCCAGCAAGGACCCTGCCCAGG + Intergenic
1065721108 10:28629470-28629492 TGGCTGCAGTGCCCCTCCCCGGG + Intergenic
1070722961 10:78769416-78769438 AGCCTGCCAGGACCCTTCCCTGG - Intergenic
1071532335 10:86400107-86400129 AGTCGGCCTGGTCCCTCCCCTGG - Intergenic
1073449178 10:103599458-103599480 AGGCTGCAGGGCCCTCCCCCTGG + Exonic
1073456630 10:103640749-103640771 AGTGTGCAGAGCCCCTTCCCAGG - Intronic
1073682380 10:105718316-105718338 TTTCTCCAGGGAACCTCCCCTGG + Intergenic
1074004791 10:109410362-109410384 AGTCTGTAGGTACTCTGCCCAGG - Intergenic
1075729916 10:124630007-124630029 GCTCTGCAGGGCCCTTCCCCTGG + Intronic
1075926292 10:126254182-126254204 GGTCTGCAGGCAGCCTCCCTGGG + Intronic
1076009993 10:126980154-126980176 AGTCTGAAGGGACCCAACGCTGG - Intronic
1076405601 10:130210532-130210554 AGTGGGAAAGGACCCTCCCCTGG - Intergenic
1076433809 10:130425941-130425963 CACCTGCAGCGACCCTCCCCAGG - Intergenic
1077096955 11:803119-803141 AGGCTTCAGGGACCCTCCCGTGG + Intronic
1077179978 11:1207931-1207953 GGTCAGCAGGGGCCCTGCCCTGG - Intergenic
1078557410 11:12341176-12341198 ACTGTGCAGGGCCTCTCCCCTGG - Intronic
1081708458 11:45200719-45200741 AGTCTGCAGGGACCCTCCCCTGG - Intronic
1082748645 11:56995269-56995291 GGGCTGCAGGCACCCACCCCTGG - Intergenic
1083180688 11:60982825-60982847 AGTCTGCAGGGACTCTTTCCAGG + Intronic
1083843122 11:65315668-65315690 GGTCTCCAGCGCCCCTCCCCCGG - Intronic
1084425163 11:69080441-69080463 AGGCTCCAGGGTCCCTGCCCAGG - Intronic
1087147788 11:94828926-94828948 TGTTTGCAGGCACCCTCACCTGG + Intronic
1087289350 11:96302583-96302605 TGTCTCCAGGGAACCTCCTCAGG - Intronic
1088697480 11:112380649-112380671 AGCCTGCACGGACCTGCCCCTGG - Intergenic
1089780419 11:120869752-120869774 TGTCTACAGGCCCCCTCCCCAGG - Intronic
1090635462 11:128688120-128688142 AGACTGCAGCTCCCCTCCCCGGG - Intronic
1090941115 11:131389212-131389234 TGGCTGCAGGGAACCTGCCCAGG - Intronic
1091284204 11:134399054-134399076 AGGCTGCAGTGAGCCCCCCCGGG - Intronic
1091616383 12:2053691-2053713 ACTCCGCAGGGACCGGCCCCGGG - Intronic
1091833619 12:3568657-3568679 ACTTTGCAGGGACCCCACCCAGG - Intronic
1092151157 12:6249824-6249846 ACTCTGCAGAGCCCCTCCTCTGG - Intergenic
1092365585 12:7873817-7873839 TGTCTGCAGGGGCCTTACCCTGG - Intronic
1092383743 12:8019366-8019388 TGTCTGCAGGGGCCTTACCCTGG - Intergenic
1095965561 12:47864787-47864809 ACTCTGGAGGGACCCTTCCAGGG + Intronic
1096263470 12:50106803-50106825 AGGCTGCAAGGACCCGGCCCAGG + Exonic
1100334321 12:93615401-93615423 ACTCTGCAGGATCCCTGCCCAGG - Intergenic
1102258767 12:111430861-111430883 GGTCCCCAGGGTCCCTCCCCGGG + Intronic
1103239776 12:119403558-119403580 TGGCTGCTGGGACTCTCCCCAGG - Intronic
1104848675 12:131860561-131860583 AGGCTGCAGGGATCCTCCTGTGG - Intergenic
1104977401 12:132558258-132558280 GCTCAGCAGGGACACTCCCCTGG - Intronic
1106135333 13:26969071-26969093 CGCCAGCAGGGCCCCTCCCCAGG - Intergenic
1106938520 13:34750476-34750498 ACTGTGCAGGGCCCCTCCCTTGG + Intergenic
1107139711 13:36984753-36984775 AGGGAGGAGGGACCCTCCCCTGG + Intronic
1120027256 14:79600516-79600538 AATCTGCAGGGACACTGTCCTGG + Intronic
1120747915 14:88168428-88168450 GGTCTGCAGGAATCCTCCTCTGG - Intergenic
1121463624 14:94100532-94100554 CTTCTGCAGGAAGCCTCCCCAGG - Intronic
1122297453 14:100713473-100713495 CGCCTCCAGGGACCCTCCCAGGG + Intergenic
1124227086 15:27903632-27903654 AGGCCGCAGGGACCCGCTCCTGG - Intronic
1125518911 15:40337635-40337657 GGGCTGCAGGGACCCTCCTCGGG - Intronic
1125716672 15:41823461-41823483 AGTCTGCAGGCCCCTTCACCAGG + Exonic
1127646379 15:60963437-60963459 AGTCTGCAGGGAACCTACAGAGG + Intronic
1128680402 15:69647346-69647368 ACTCTGCAGAGCTCCTCCCCAGG + Intergenic
1129771635 15:78206677-78206699 TGTCTGAAGGGACCCTCTCTGGG + Intronic
1131389307 15:92034167-92034189 AGTCTCCAGGATCCCTCTCCTGG - Intronic
1132061490 15:98695951-98695973 AGTTTTCAGGGTCTCTCCCCTGG + Intronic
1132149664 15:99450680-99450702 AGTCTGCTGGGCCCACCCCCAGG + Intergenic
1132780236 16:1620276-1620298 AGACAGCAGGGACCCTTCCCAGG - Intronic
1133014799 16:2934445-2934467 AGACAGCCGGGACCCTCCTCGGG - Intronic
1133052185 16:3123638-3123660 CATCTGCAGGCACCCTCCACGGG - Intergenic
1133621086 16:7526999-7527021 GGTCTGCTGGGGCCCTCCCCAGG - Intronic
1134051760 16:11142241-11142263 AGTGTCCAGGGATCCTCCTCAGG + Intronic
1136265869 16:29117826-29117848 CATCTGCAGGGACCGCCCCCCGG - Intergenic
1137400947 16:48154075-48154097 TGGCTGCAGGGACCCTGGCCCGG - Intronic
1139653520 16:68374281-68374303 AGTCTGCAGTCACCATCTCCAGG + Intronic
1141673637 16:85506087-85506109 TGTCTGCAGGTCACCTCCCCGGG - Intergenic
1141815110 16:86404558-86404580 AGTCTCCAGGGTCCCTCCAATGG + Intergenic
1142054682 16:87985733-87985755 CGTCTGCAGGGACTGCCCCCCGG - Intronic
1142491434 17:282170-282192 TGTTTGCCTGGACCCTCCCCTGG - Intronic
1142662010 17:1437137-1437159 AGTCTGGAGGGGCTCACCCCTGG + Exonic
1143088410 17:4434013-4434035 GGTCTGCAGGGCCAGTCCCCAGG + Exonic
1146691139 17:34876950-34876972 AGCCTGCAGGGACCCAGCCAGGG - Intergenic
1148022011 17:44559428-44559450 AGTCTGTAGGGGCCCCACCCCGG - Exonic
1149251883 17:54779734-54779756 AGCCTACAGGGACCCTGTCCTGG - Intergenic
1151545473 17:74790369-74790391 AATCTGCGGGGAGCCTCTCCAGG - Intronic
1152137116 17:78511015-78511037 AGGCAGGAAGGACCCTCCCCCGG + Intronic
1152138893 17:78524950-78524972 ATTCTGCAGGGAGCTGCCCCCGG - Intronic
1152441485 17:80312656-80312678 AGTCTGCAGGGCCCCTCTCTGGG + Intronic
1152581977 17:81169625-81169647 AGGCAGGAAGGACCCTCCCCTGG - Intergenic
1155867850 18:30988399-30988421 AGTTTCAAGAGACCCTCCCCAGG - Intergenic
1156470327 18:37373732-37373754 AGCCTCCCTGGACCCTCCCCAGG - Intronic
1158490101 18:57902386-57902408 AGCCAGGAGGGAGCCTCCCCTGG + Intergenic
1158495136 18:57948664-57948686 AGTTGGCAGGAAGCCTCCCCAGG - Intergenic
1160688418 19:448343-448365 AGGCAGGAAGGACCCTCCCCCGG - Intronic
1160802054 19:974687-974709 ACCCTGCACGGCCCCTCCCCAGG - Exonic
1162822029 19:13228991-13229013 GGACTGCAGGGCACCTCCCCTGG + Intronic
1163031040 19:14544324-14544346 AGTATCCAGAGACCCTCCCCAGG - Intronic
1165599028 19:37037171-37037193 AGCCTGCATGGCCTCTCCCCTGG - Intronic
1166075529 19:40411774-40411796 ACAAGGCAGGGACCCTCCCCAGG - Intronic
1166141681 19:40808553-40808575 AGTCTGGGGGGACACTGCCCAGG + Intronic
1166253222 19:41585492-41585514 AGACTGAAGGGACACTCACCGGG - Exonic
1166355010 19:42221860-42221882 AGGCTGCAGTGAGCCTCCCTTGG - Intronic
1166956866 19:46470729-46470751 GGTCTGTAGAGACCCTACCCAGG - Exonic
1166996427 19:46721808-46721830 AGTCCGCTGGGGCCCTCCTCTGG - Intronic
1168081214 19:54012012-54012034 AGTCAGCCCGGAGCCTCCCCCGG + Exonic
1168450955 19:56466290-56466312 AGTCTGCAGGGCCACCTCCCAGG - Intronic
926551939 2:14311476-14311498 ACTCTGCAGGGAGTCTCCACTGG - Intergenic
926890270 2:17633653-17633675 AGTCAGGAGTGACCCTTCCCTGG + Intronic
927485807 2:23487694-23487716 TGTCTGCAGTGCCCCTACCCAGG - Intronic
928106142 2:28471761-28471783 GGGCTGAAGGGACCCTCCTCGGG + Intronic
930002237 2:46869241-46869263 AGTCTGCAGGGACACTGTCCAGG - Intergenic
933219236 2:79669599-79669621 AGTCAGCAGCCACCCTCTCCAGG - Intronic
933639501 2:84744180-84744202 TGTCTGCAGGGGCTCTCCTCTGG - Intronic
934176996 2:89585119-89585141 GCCCTGCAGGGACCCCCCCCGGG - Intergenic
934529710 2:95077237-95077259 AACCTGCAGGGACCCTACCAGGG + Intergenic
935956049 2:108377657-108377679 AGACTGCAGGGACTTTCCCGTGG - Intergenic
937298039 2:120821569-120821591 AGAGTGCAGGTCCCCTCCCCAGG - Intronic
937314603 2:120922971-120922993 ACTCTGTGGGAACCCTCCCCAGG + Intronic
937462435 2:122101171-122101193 GCTCTGCAGGGACCCTTCTCTGG - Intergenic
946195051 2:218027861-218027883 AGTCTGCAGGGCCTCTGGCCTGG - Intergenic
946961963 2:224994997-224995019 AGGCTGCAGGTGCCCTCCCACGG + Intronic
948282433 2:236757643-236757665 AGGCTGCCTGGACCTTCCCCAGG + Intergenic
948789847 2:240371580-240371602 AGCCTGCAGGGCCCCTTCCAGGG - Intergenic
1175569610 20:60008945-60008967 GGGCTGCAGGGCCCTTCCCCAGG + Intronic
1175860591 20:62148190-62148212 TGGCTGCGGGGTCCCTCCCCGGG - Intronic
1176073265 20:63237556-63237578 AGCCAGAAGGGCCCCTCCCCAGG - Intronic
1176270228 20:64232419-64232441 AGTCAGTAGGGACCCTCGCCTGG + Intronic
1179358583 21:40684279-40684301 AGTCTGCAGGAACGCTCCACAGG + Intronic
1179501505 21:41812163-41812185 AGTAGGGAGGGTCCCTCCCCAGG + Intronic
1180062846 21:45394395-45394417 AGTCTCCAGGGAACCCACCCAGG - Intergenic
1180636218 22:17264876-17264898 AATCCCCAGGGACCTTCCCCAGG + Intergenic
1180936011 22:19625787-19625809 TGTGTGCAGGGACCCTGCCCAGG + Intergenic
1181343702 22:22201830-22201852 TGTCTGCAGGTTCCCTCTCCCGG + Intergenic
1181568517 22:23753662-23753684 TGGCTGCAGGGACCCTCTCAGGG + Intronic
1181756537 22:25028562-25028584 AGCCTGCGGGGACCCTTCCCCGG + Exonic
1183956344 22:41382468-41382490 ACGCTCCAGGGCCCCTCCCCCGG + Intronic
1185051430 22:48556186-48556208 AGTCCCCTGGGAGCCTCCCCAGG - Intronic
953108481 3:39909172-39909194 AGTCTCCAGGCTCTCTCCCCAGG - Intronic
954316961 3:49806455-49806477 AGGCTGCAGGGGCCCTGCTCTGG - Intronic
955328015 3:58024485-58024507 AGTCTGGAGAGACCACCCCCAGG - Intronic
956564634 3:70622266-70622288 AGTCTGCAGGCACACTTCTCTGG - Intergenic
960610844 3:119553577-119553599 AGTCTGCAGTGCCCCTCCCAGGG + Intronic
960939027 3:122921814-122921836 AGACTGCAGGGACCGACCCCAGG + Intronic
960965957 3:123104867-123104889 AGTCTGCAGGGAGCAGCACCTGG - Intronic
961009732 3:123427576-123427598 AGTCTCCTAGGACCCTCCACTGG + Intronic
961390296 3:126548665-126548687 AGACTCCAGGCTCCCTCCCCAGG - Intronic
962191446 3:133315333-133315355 AGGGAGGAGGGACCCTCCCCAGG - Intronic
966933025 3:184687873-184687895 GGTCTCCCGGGCCCCTCCCCGGG + Intergenic
967769801 3:193322022-193322044 GGACTGCAAGGACCTTCCCCTGG + Intronic
967939847 3:194757243-194757265 AGGCTGCTGGCATCCTCCCCTGG + Intergenic
968447468 4:658966-658988 AGTCAGCAGGCTCCTTCCCCAGG - Exonic
968498414 4:931884-931906 CCTCGGCAGAGACCCTCCCCTGG + Intronic
968757264 4:2423306-2423328 GGCCTGCTGGGACCCTCCCGAGG + Intronic
968972710 4:3804219-3804241 GGTCTGCAGGGACACACACCTGG - Intergenic
969245671 4:5931173-5931195 AGTCTGCAGGGACTCTTTGCAGG - Intronic
969484935 4:7466917-7466939 AGGCAGCAGGGTGCCTCCCCTGG - Intronic
971287903 4:25308003-25308025 AACCTGCAGAGACCCTGCCCCGG - Intergenic
971845448 4:31912904-31912926 AGCCAGCAGGGACACTCCCATGG - Intergenic
972314299 4:37911552-37911574 ATCCTGCAGGGACCCTTTCCTGG + Intronic
976802712 4:89010625-89010647 AGTTTGCAGGGATCTTTCCCTGG + Intronic
977619546 4:99120649-99120671 GGGCTGCAGGCACCCACCCCTGG + Intergenic
979638955 4:122989648-122989670 AGTCTGCAGGGATCCATCCTGGG + Intronic
982263796 4:153520018-153520040 AGTCTACACAGACCTTCCCCAGG - Intronic
983461160 4:168027403-168027425 AGTCTTCAGAGAACCTACCCAGG + Intergenic
985481068 5:111272-111294 AGTCTGCAGGCAGCTTCCCTGGG + Intergenic
985886451 5:2683888-2683910 GGGCTGCAGGCACCCTCCACGGG - Intergenic
985947965 5:3201315-3201337 AGTCAGGAGGGCTCCTCCCCTGG - Intergenic
985960025 5:3294284-3294306 ATTCTGCAGGAACCATCTCCTGG - Intergenic
987049098 5:14134805-14134827 ACCCCTCAGGGACCCTCCCCAGG + Intergenic
991768707 5:70018615-70018637 GGTCTTCTGGGACCCTTCCCCGG + Intergenic
991847945 5:70893692-70893714 GGTCTTCTGGGACCCTTCCCCGG + Intergenic
1001543034 5:172552405-172552427 AGACTGCCAGGTCCCTCCCCAGG - Intergenic
1002316711 5:178348667-178348689 GGTCTGCAGAGCCCCTTCCCAGG + Intronic
1002319171 5:178364863-178364885 ACACTGCAGGGAGCCTGCCCAGG + Intronic
1002850870 6:995444-995466 AGGCTGCAGGGACACACCTCAGG + Intergenic
1005869738 6:29965995-29966017 GGGCTGCAAGGATCCTCCCCTGG - Intergenic
1013330099 6:109092078-109092100 AGTCTATAGGGAACCTTCCCAGG + Intronic
1014999964 6:128202474-128202496 AGTATGTAGTGACCCTCCCTGGG - Intronic
1015785215 6:136916295-136916317 AGTCTGGAGTGACCCTACCAAGG + Intergenic
1017171971 6:151465417-151465439 AGCCTCCATGGACCCTTCCCTGG - Intronic
1017311818 6:152983901-152983923 AGTGTGCAGCTACGCTCCCCTGG + Intergenic
1018891840 6:167988326-167988348 AGGCAGGAGGGGCCCTCCCCTGG + Intergenic
1019376739 7:696868-696890 AGCGAGCAGGGCCCCTCCCCAGG + Intronic
1023052611 7:36266377-36266399 AGTCTAGAGGCAGCCTCCCCAGG + Intronic
1023183883 7:37513680-37513702 ACTCTGCTTGGTCCCTCCCCGGG - Intergenic
1024282536 7:47731429-47731451 AGTCAGGAGGAACCCTCCCCTGG + Intronic
1024513222 7:50219357-50219379 AGTGCTCAAGGACCCTCCCCAGG - Intergenic
1026564696 7:71480373-71480395 TGACTGCAGAGACCCTGCCCAGG - Intronic
1027655021 7:80919479-80919501 AGGCTGCAGTGATCCTTCCCTGG - Intronic
1031840217 7:126728774-126728796 AGCCAGCAGGAAGCCTCCCCTGG - Intronic
1032782126 7:135171783-135171805 CCTCTGCAGGGACGCTCCACAGG - Intergenic
1034329425 7:150269656-150269678 GGTAAGCAGGGGCCCTCCCCAGG + Intronic
1034426759 7:151018118-151018140 AGTCCCCAGCGACCCTCGCCAGG + Intronic
1034472190 7:151261139-151261161 GGACTGCAGAGACCCTGCCCAGG - Intronic
1034668631 7:152840205-152840227 GGTAAGCAGGGGCCCTCCCCAGG - Intronic
1035102736 7:156414868-156414890 TGTCTGCAGGCAGCCTCCCTGGG - Intergenic
1035328097 7:158077723-158077745 AGTCTGCAGAGACCCTCACCCGG - Intronic
1040303419 8:46199900-46199922 GGAATGCAGGGAGCCTCCCCTGG + Intergenic
1045710594 8:104978836-104978858 AATCTGGAGGTAGCCTCCCCGGG - Intronic
1047599164 8:126409125-126409147 AGGCTGCATGGCCCCTCTCCAGG + Intergenic
1048525840 8:135201750-135201772 AGGCTGAAGGGACCTGCCCCTGG + Intergenic
1049289004 8:141791727-141791749 AGTCAGAGGGGACCCTGCCCAGG - Intergenic
1049383760 8:142330677-142330699 AGCCTGCAGGTGCCCTCCACAGG - Intronic
1049427500 8:142543963-142543985 AGGCTGTGGGGACCCTGCCCTGG - Intronic
1050428462 9:5536663-5536685 AGTAGGCAGGGTGCCTCCCCAGG - Intronic
1052817186 9:33110851-33110873 AGTCAGCAGAGACCCTGTCCAGG + Exonic
1056809948 9:89756568-89756590 AGTGTGCAGGGAGCATCCTCAGG + Intergenic
1060209881 9:121703155-121703177 AGCTTCCAGGGACCCTCACCTGG + Intronic
1061422202 9:130478513-130478535 AGACCGGAGGAACCCTCCCCTGG + Intronic
1061678810 9:132232549-132232571 AGAGTGCAGGGATACTCCCCAGG - Intronic
1061679362 9:132235431-132235453 AGTCTGCATGTGCCCTCCACAGG + Intronic
1062261659 9:135665969-135665991 AGGCTGCGGGGTCCCACCCCAGG + Intronic
1062445531 9:136592585-136592607 AGGCAGAAAGGACCCTCCCCTGG + Intergenic
1062636336 9:137493572-137493594 GGCTTGCAGGGACCCTGCCCAGG + Intronic
1185530476 X:814473-814495 AGGCAGGAAGGACCCTCCCCTGG + Intergenic
1185530537 X:814812-814834 AGGCAGGAAGGACCCTCCCCTGG + Intergenic
1185616850 X:1427231-1427253 AGGCAGGAAGGACCCTCCCCTGG + Intronic
1189535218 X:41928136-41928158 AGGCTGAAGGTACCCTTCCCAGG + Intergenic
1192189493 X:68982195-68982217 AGTGTGCTGTCACCCTCCCCAGG + Intergenic
1195244561 X:102983759-102983781 AGTCTGTAAGGCCCTTCCCCAGG + Intergenic
1199896124 X:152129526-152129548 AGTCTGCAGTGACCCTGTCGTGG - Intergenic
1202176675 Y:22104832-22104854 GGTCTGCAGGGAGCCCCACCTGG + Intergenic
1202214686 Y:22481552-22481574 GGTCTGCAGGGAGCCCCACCTGG - Intergenic