ID: 1081709680

View in Genome Browser
Species Human (GRCh38)
Location 11:45208791-45208813
Sequence CTGGGGGCCAGCAATTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 192}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081709673_1081709680 -7 Left 1081709673 11:45208775-45208797 CCTCCTGGCTCCCCAGCTGGGGG 0: 1
1: 1
2: 1
3: 60
4: 442
Right 1081709680 11:45208791-45208813 CTGGGGGCCAGCAATTAGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 192
1081709669_1081709680 0 Left 1081709669 11:45208768-45208790 CCAGGTGCCTCCTGGCTCCCCAG 0: 1
1: 0
2: 5
3: 71
4: 609
Right 1081709680 11:45208791-45208813 CTGGGGGCCAGCAATTAGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 192
1081709675_1081709680 -10 Left 1081709675 11:45208778-45208800 CCTGGCTCCCCAGCTGGGGGCCA 0: 1
1: 0
2: 2
3: 41
4: 385
Right 1081709680 11:45208791-45208813 CTGGGGGCCAGCAATTAGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 192
1081709665_1081709680 10 Left 1081709665 11:45208758-45208780 CCAGGTTGCCCCAGGTGCCTCCT 0: 1
1: 1
2: 0
3: 20
4: 284
Right 1081709680 11:45208791-45208813 CTGGGGGCCAGCAATTAGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 192
1081709668_1081709680 1 Left 1081709668 11:45208767-45208789 CCCAGGTGCCTCCTGGCTCCCCA 0: 1
1: 0
2: 2
3: 52
4: 451
Right 1081709680 11:45208791-45208813 CTGGGGGCCAGCAATTAGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 192
1081709667_1081709680 2 Left 1081709667 11:45208766-45208788 CCCCAGGTGCCTCCTGGCTCCCC 0: 1
1: 1
2: 3
3: 54
4: 626
Right 1081709680 11:45208791-45208813 CTGGGGGCCAGCAATTAGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081709680 Original CRISPR CTGGGGGCCAGCAATTAGGA AGG Intronic
902617991 1:17634452-17634474 CTGGGGGCCAGCCATGGGGCTGG - Intronic
903058651 1:20654324-20654346 CTGGAGCCCAGCAATGAGGAGGG + Exonic
906282827 1:44565881-44565903 GTGGGGGCCAGCCATGAGGTGGG - Intronic
906621994 1:47289710-47289732 CTGGGGTCCACCACTTAGGAAGG + Intronic
907490566 1:54806359-54806381 GTGGGGGCCGGCAGTGAGGAGGG + Intronic
911712448 1:101089575-101089597 CTGGTGGTAAGAAATTAGGAAGG - Intergenic
912058626 1:105636332-105636354 CTGAGGGACAGCAAGGAGGAGGG - Intergenic
912717929 1:111995022-111995044 CTGGAGCCCAGCAAGTTGGATGG - Intergenic
921911183 1:220550992-220551014 CTCAGGGCCAGCAGTCAGGAGGG + Intronic
1063015199 10:2070327-2070349 GTGGTGGCGAGCAATTAGGAGGG - Intergenic
1064203938 10:13306916-13306938 GTGGGGGCCAGCAGTGGGGAAGG - Intergenic
1064236702 10:13582657-13582679 CTGGGGGCCTGAGAATAGGAAGG - Intergenic
1067723243 10:48745907-48745929 CTGGGGGCCAGGAAATAACAGGG + Intronic
1069334208 10:67328627-67328649 CTGGGGGCCAGGAATGAGTGTGG + Intronic
1074882224 10:117668003-117668025 CTGGGGTCCAGCAGAAAGGAAGG + Intergenic
1074970017 10:118528469-118528491 GTGGGGGCCAGCACTTTGGAAGG - Intergenic
1075964344 10:126598175-126598197 CTGGTGGGCAGCAATGAGCAAGG - Intronic
1076736551 10:132461669-132461691 CTGAGGGCCAGCAGTTAGGGCGG + Intergenic
1077663564 11:4089753-4089775 CTGAGGGTCAGAAGTTAGGAAGG - Intronic
1080684942 11:34507466-34507488 CTGGAGCACAGCAATTAGAATGG - Intronic
1081579738 11:44344037-44344059 CTTGGGGCTTGCAATTGGGAAGG + Intergenic
1081709680 11:45208791-45208813 CTGGGGGCCAGCAATTAGGAAGG + Intronic
1084003955 11:66313591-66313613 TTGGGGGCCTCTAATTAGGACGG - Intergenic
1085852009 11:80131514-80131536 ATGGGGGTCAGCAATTTAGATGG - Intergenic
1089350582 11:117819594-117819616 CTTGGGGCCACCTATTTGGAGGG - Intronic
1091186911 11:133655514-133655536 CAGGGGACCAGCAATTATCAAGG + Intergenic
1091390949 12:125782-125804 CTGGGGGCCAGCCCTTGGGGAGG - Exonic
1091656172 12:2348295-2348317 CTCAGGGCCAGCACTCAGGACGG - Intronic
1096190745 12:49616931-49616953 CAAAGGGCTAGCAATTAGGAAGG + Intronic
1097268725 12:57761103-57761125 GTTGGGGCCAGCAATCAGTATGG + Intergenic
1097723565 12:63049768-63049790 CTGAGGGACAGCAGTTGGGAAGG - Intergenic
1098340765 12:69448705-69448727 TTGTGGGCCAGCAAATAGGTCGG + Intergenic
1102098479 12:110258898-110258920 CTTGGGGCAGGCCATTAGGAAGG + Intergenic
1102502084 12:113359553-113359575 CTGGGTTCCAGCAATAAAGATGG - Intronic
1102727363 12:115077498-115077520 CTGTGGGTCAGGAATTTGGATGG - Intergenic
1107449084 13:40492459-40492481 CTGGGGACCAGCATCTGGGAGGG - Intergenic
1108732836 13:53252880-53252902 CTGGGTCCCAGCAATGACGAAGG - Intergenic
1112579754 13:100668387-100668409 CTTGGTGCCAGCAATAAGAAAGG + Intronic
1118170355 14:63382703-63382725 CTGGGTGCCAATAATTAGAAGGG - Intronic
1119734262 14:76971420-76971442 CTGGGGACCAGCGATTAGGGAGG - Intergenic
1120190004 14:81432041-81432063 CTGGTAGCCAGCACTTAGAATGG + Intronic
1121322392 14:92999576-92999598 CTGAGGCCCAGCAAGGAGGAGGG - Intronic
1121449114 14:93996535-93996557 GTGGGGGCCAGGAATGAGGGAGG - Intergenic
1122227402 14:100287635-100287657 CTTGAGGCCAGGAATTCGGAGGG - Intergenic
1123008519 14:105335927-105335949 CTGGGGCCCAGCTACGAGGATGG + Intronic
1125517716 15:40332019-40332041 CTGGGGGCCTGGAAAAAGGAGGG - Intronic
1128509681 15:68305747-68305769 CTGGGGGCCAGCAAATGGCAGGG + Intronic
1130334536 15:82947986-82948008 CTGGGGCCCAGCACTTTGGGAGG + Intronic
1130840872 15:87700331-87700353 CTGTGAGACAGCAGTTAGGAGGG + Intergenic
1132310923 15:100857521-100857543 CTGGGGGATAGAAATTAGCACGG - Intergenic
1135057133 16:19240821-19240843 TTGGGTGCCAGCAAGTATGACGG - Intronic
1135221121 16:20614727-20614749 CTGGAGGCCAGCTAGTAGGTGGG + Intronic
1137730668 16:50687321-50687343 CTGAGGTCCAGCAACAAGGAAGG + Intergenic
1140148531 16:72337104-72337126 CTGGGAGCCAGCACTTTGGGAGG + Intergenic
1140684458 16:77419683-77419705 CTGGGAGCCAGCAATTTTGGGGG + Intronic
1140890226 16:79278794-79278816 TTGGGGGCCAGCAGGCAGGAAGG - Intergenic
1141988471 16:87595095-87595117 CTGGGAGCCACCAAGGAGGAGGG + Intergenic
1144058353 17:11560376-11560398 CTGGGGACCAGCCCTTAAGAAGG - Exonic
1145265658 17:21378483-21378505 CTGGGGGCCTGCCATTTGGTGGG + Intronic
1145894627 17:28447222-28447244 CTGGGGGTCTGCAATAAGGGCGG + Intergenic
1146289052 17:31595135-31595157 CCTGGGGCCAGCACTTTGGAAGG - Intergenic
1147755300 17:42763293-42763315 CTGGGGGCCTGCAACTGGGGAGG + Intergenic
1148103759 17:45108468-45108490 CTGAGAGCCAGCAAGTAGGGGGG - Exonic
1148320279 17:46745096-46745118 CTGGTGGCCACACATTAGGAAGG + Intronic
1148496639 17:48056905-48056927 CTCGGGGCCAGCCATTAGCCTGG + Intronic
1149045846 17:52244475-52244497 CTGGAGGAGAGGAATTAGGACGG - Intergenic
1149341961 17:55696445-55696467 CTTGGGGGCAGCAATCAGGTTGG - Intergenic
1150811722 17:68362174-68362196 ATGGGGGCCAGCAATGAAGACGG - Intronic
1151554692 17:74840776-74840798 CTGGAGGCCAGCACTCTGGAAGG - Intergenic
1151763995 17:76122692-76122714 CTGGGGGCCGCAAATGAGGAGGG + Intergenic
1155927593 18:31673471-31673493 CTGGTGGTCAGCAACGAGGATGG + Intronic
1156300802 18:35834421-35834443 CAGGGGGCCAGGAATTATAAAGG + Intergenic
1157020227 18:43772660-43772682 CTTGGTGCCTGCAAGTAGGATGG - Intergenic
1157475223 18:48019732-48019754 CTGGGGACCAGCAGAGAGGAGGG - Intergenic
1157670347 18:49523338-49523360 CTGGGCTCCAACAATTAGGGTGG - Intergenic
1157869790 18:51219325-51219347 CTGGAGGCCACCAATAAGGTAGG + Intergenic
1159524565 18:69570696-69570718 CTGGGGGTCAGTGATTTGGAGGG + Intronic
1160051557 18:75438731-75438753 CCAGGTGCCTGCAATTAGGATGG - Intergenic
1160565686 18:79785486-79785508 TTGGGGGCCGGGAATTTGGAGGG + Intergenic
1160613524 18:80107612-80107634 TTTGGGCTCAGCAATTAGGAGGG + Intergenic
1161238526 19:3209429-3209451 CACGGGGCCAGCATTTTGGAGGG + Exonic
1161496902 19:4591445-4591467 CTGGAGGCCAGGAAGGAGGAGGG + Intergenic
1163014108 19:14443335-14443357 CTGGGGGCCAGCAGACAGGCAGG - Intronic
1164397383 19:27877931-27877953 CTGGGACCCAGGAATCAGGAAGG + Intergenic
1165094475 19:33402789-33402811 CTGGGGGCCAGCAGAGAGGCAGG + Intronic
1165126181 19:33599542-33599564 CTTGGGGCCAGCCATCAGGGAGG - Intergenic
1165692450 19:37874096-37874118 CTTGTGGCCAGCACTTGGGAGGG + Intergenic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1166703086 19:44893362-44893384 GTGGGGGCTAGTTATTAGGAAGG + Intronic
1166878741 19:45914167-45914189 CTGGGGGCCAGAAATTCCAAAGG + Exonic
1167096276 19:47376530-47376552 CTGGAGGCCAGCAACTGCGACGG + Exonic
1167333830 19:48872689-48872711 CTGGGGGCCCGGATTTAGAAAGG + Intronic
926530075 2:14033225-14033247 CTGTGGGTCAGAAATTAGGGAGG - Intergenic
927190470 2:20513652-20513674 CTGGGAGACAACAATGAGGACGG - Intergenic
932609173 2:73186142-73186164 CTGGGGGTCAGGAATTTGGGCGG + Intergenic
932750064 2:74365846-74365868 CTGGGGGCCAGGAAATTGGTAGG - Intronic
933759700 2:85665165-85665187 CTGGCTGCCAGAAGTTAGGAGGG - Intronic
933833734 2:86230043-86230065 AAGGGGGCCAGCAGTGAGGAGGG + Intronic
934696123 2:96401607-96401629 TTGGTGTCCACCAATTAGGATGG + Intergenic
937223282 2:120353986-120354008 GGTGGGGCCAGCATTTAGGAGGG + Intergenic
948182128 2:235990345-235990367 CTGTGGGTCAGGAATTAGAATGG + Intronic
1172098822 20:32473764-32473786 GCCGGAGCCAGCAATTAGGAGGG - Intronic
1172646421 20:36472974-36472996 CTGGGAGACAGCCAGTAGGATGG + Intronic
1173113398 20:40217550-40217572 CACAGGGCCAGCAAATAGGAGGG + Intergenic
1174935969 20:54869073-54869095 CTGGGGTGCAGCAGGTAGGATGG - Intergenic
1175749245 20:61483816-61483838 CTGTGGGTCAGCAATTTCGACGG - Intronic
1178525440 21:33324790-33324812 CAGGGGTGCTGCAATTAGGATGG + Intronic
1179373740 21:40830361-40830383 CTTGGCGCCATCCATTAGGAGGG - Intronic
1179707976 21:43193596-43193618 CTGGGGGCCTGCCTGTAGGATGG + Intergenic
1179727295 21:43347633-43347655 CTGGGGGCCGGCACTGTGGACGG - Intergenic
1181684064 22:24516341-24516363 CTGGGGCCCCTCATTTAGGAGGG + Intronic
1181694700 22:24587267-24587289 CTGGGGGCCGGCCATGAGGGAGG + Intronic
1181764940 22:25084654-25084676 CTGTGGGTCAGAAATTAGGCAGG + Intronic
949310620 3:2693860-2693882 TTGGGGCCCAGCAACTCGGAAGG - Intronic
950451472 3:13067994-13068016 CTGCGGGCCAGCAAGCAGGCTGG - Intronic
950602350 3:14045877-14045899 CTGGGGGCGGGCATTTAGGCTGG + Intronic
950777959 3:15366592-15366614 CTGGGCTCAAGCAATCAGGAGGG - Intergenic
951266450 3:20573553-20573575 CTGAATGCCAGCAATTAGGGTGG + Intergenic
952638176 3:35557330-35557352 CTGGGGGCTAGGGAGTAGGATGG - Intergenic
954907171 3:54072716-54072738 CAGGGGGCCAGGAATTATAAAGG + Intergenic
956078772 3:65534996-65535018 ATATGGCCCAGCAATTAGGAAGG + Intronic
960909386 3:122633921-122633943 CTGGGGACCATGAATTAGTAAGG - Intronic
961383459 3:126510577-126510599 CTGGGGGCCAGGAACAAGGAGGG - Intronic
965329413 3:167351929-167351951 TTGTGGGCCAGCAACCAGGAAGG - Intronic
966396703 3:179511064-179511086 CTGGGTGGCAGCAGTTGGGACGG + Intergenic
966865198 3:184254965-184254987 TTTGGGGCCAGCAACTAAGAAGG - Intronic
968064122 3:195748813-195748835 AAGGGGTCCAGGAATTAGGATGG - Intronic
969582082 4:8071484-8071506 GCGGGCGCCAGCACTTAGGATGG + Intronic
969671371 4:8592144-8592166 CTGGGTGCCAGCAATGAGTTGGG + Intronic
978026126 4:103877033-103877055 CTGGGAGCCAGCAATAAGTTTGG - Intergenic
985901291 5:2796729-2796751 CTGTGGGTCAGGATTTAGGATGG + Intergenic
986341217 5:6791012-6791034 CGAGGGGCCAGCAACAAGGAAGG - Intergenic
988388241 5:30594378-30594400 CAGAGGGCCAGCAAATAGAAGGG + Intergenic
994091873 5:95816995-95817017 CTGGGTCACAGCAATCAGGAAGG + Intronic
995602017 5:113807632-113807654 CTGCAGGCAAGCAAATAGGAGGG + Intergenic
995965214 5:117898426-117898448 GTGGTTGCCAGCATTTAGGAGGG + Intergenic
996837807 5:127813175-127813197 CTGGGCCCCCGCAATGAGGAAGG - Intergenic
998298653 5:140996500-140996522 TTGGGGCCCAGCATTTAGAAAGG + Intronic
999258852 5:150225462-150225484 CTGGGGGCCAGCACTAAGATGGG + Intronic
1000437938 5:161236279-161236301 CTTGAGATCAGCAATTAGGAGGG - Intergenic
1004341881 6:14815144-14815166 CTGGGGGCTCGGAATTTGGATGG - Intergenic
1004495566 6:16159773-16159795 CTGAGGGTCAGCAAGAAGGATGG + Intergenic
1005350532 6:24930463-24930485 CTGGGGGCCATAAATCAGGGGGG + Intronic
1006080139 6:31560381-31560403 CTGGGGGCCAGACACCAGGAAGG - Intergenic
1007171230 6:39864957-39864979 CTGAGGGCCAGCAGGTAGAAAGG - Intronic
1009519721 6:64665928-64665950 CTGGAGGCCAGGAACTTGGATGG + Intronic
1011376799 6:86695625-86695647 CTGGTTGCCAGCATTAAGGAGGG + Intergenic
1011647736 6:89476443-89476465 CTGGGTGCCAGCACTTTGGGAGG - Intronic
1011692670 6:89884496-89884518 CAAGGGGCCAGCATTTTGGAAGG - Intergenic
1012741564 6:103022053-103022075 ATGAGGCCCACCAATTAGGAAGG - Intergenic
1013606866 6:111758766-111758788 CTGCAGCCCAGCATTTAGGACGG + Intronic
1015136998 6:129883488-129883510 CTGGGAGGCAGCAGTTTGGAGGG + Intergenic
1018582806 6:165322218-165322240 CTGGGGCCCAGCACATGGGATGG - Intergenic
1018910578 6:168098918-168098940 CTGGGGTCCACCTATGAGGAGGG + Intergenic
1019903311 7:4041604-4041626 CTGGGGGTCGGCAGTCAGGAGGG - Intronic
1021481646 7:21124392-21124414 CTAGGGGCAAGGAATTATGACGG - Intergenic
1022832771 7:34085077-34085099 CTGAGGGATAGCAATTAGAAGGG + Intronic
1023058218 7:36306630-36306652 CTCAGGGTCAGCAATGAGGAAGG - Intergenic
1026857998 7:73767709-73767731 ATGGTGGCCAGAAATTAGGCAGG - Intergenic
1026877226 7:73886698-73886720 CTGGGGGCCAGCGGACAGGATGG - Intergenic
1026940808 7:74286983-74287005 CTGGGGGCCATCAGTGAGGGAGG + Intergenic
1027263085 7:76478858-76478880 CTGGGGGGCAGCCATCAGGTGGG + Intronic
1027314468 7:76976963-76976985 CTGGGGGGCAGCCATCAGGTGGG + Intergenic
1029617026 7:101665479-101665501 CAGGGGGCCAACAATGAGAAAGG + Intergenic
1031380181 7:121076122-121076144 ATGGGGGCCAGAATTAAGGAAGG + Intronic
1032186590 7:129732017-129732039 CTGGGGACCAGCAGAGAGGAAGG - Intronic
1032854207 7:135820875-135820897 CTAATGGCCAGCAATGAGGAAGG + Intergenic
1034526632 7:151667875-151667897 CTGTGGGTCAGCAATTTGGGTGG - Intronic
1038039254 8:23710135-23710157 CTGGGCGCCAGCGCTTAGGCAGG - Intergenic
1039494315 8:37969247-37969269 CTGGGGGCTGGGAGTTAGGAAGG + Intergenic
1039546957 8:38417305-38417327 CTGGGGGCCTGCACGCAGGATGG - Exonic
1039782292 8:40797381-40797403 CTGGGGCCCAGCACGCAGGATGG - Intronic
1040717534 8:50275660-50275682 CTGGGGGCCCGGACTTAGGTGGG - Intronic
1042805365 8:72765177-72765199 CTGAGCCCCAGCAATTAGGATGG + Intronic
1042821842 8:72937693-72937715 CTGGGGGACAGCCCTTTGGAAGG - Exonic
1043728095 8:83637950-83637972 CTACGGGCCAGAAATTAGAAGGG + Intergenic
1045440153 8:102201288-102201310 CTCAGGGCCAGCATTTGGGAGGG - Intergenic
1048795484 8:138145650-138145672 CTGAGCGCCAACAGTTAGGAAGG + Intronic
1048982142 8:139708330-139708352 ATGGAGGCCAGCTATCAGGATGG - Intergenic
1053012897 9:34645236-34645258 CTGGGGGCCAGCTGTTTGGGAGG + Intronic
1054740225 9:68798861-68798883 CTGAGGTGTAGCAATTAGGATGG + Intronic
1055818091 9:80231414-80231436 CTGGGGGCAAGCAATGTGGCTGG + Intergenic
1056243207 9:84669572-84669594 CTGGGGGCGAGCAGGGAGGAGGG - Intronic
1057530255 9:95838709-95838731 CTGGGGACCAGCAGTTTGCAAGG - Intergenic
1058213633 9:102204340-102204362 CTGGGGGATAGGAATTAGTAGGG - Intergenic
1059067355 9:111099456-111099478 CTGGGGGCTAACATTTAGCAAGG + Intergenic
1060978004 9:127776708-127776730 CTGAGGCCCAGCAATGGGGAGGG + Intronic
1062464537 9:136675317-136675339 CAGGGGGCCAGCAGGTAGGCTGG + Intronic
1062488924 9:136795009-136795031 CTGGGGGACAGAAATTTGGGGGG - Intronic
1189107837 X:38255787-38255809 CTCAGGGCCAGCAAGAAGGAAGG - Intronic
1189365850 X:40387820-40387842 CTCAGGGCCAGCAAGAAGGAAGG - Intergenic
1190507137 X:51137339-51137361 CTGGGCCCCAGCTATTTGGATGG + Intergenic
1190655118 X:52604992-52605014 CTGTGTGTCAGGAATTAGGAAGG - Intergenic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1192410440 X:70928768-70928790 CTTGGGGCCAGGGATAAGGATGG - Intronic
1192759896 X:74086110-74086132 CTCTGGGCCTGCAATCAGGAAGG - Intergenic
1195924539 X:110012609-110012631 CTGGGGGTCAGCATGTAGGGTGG - Intronic
1196206656 X:112947440-112947462 CTGTGGGCCAGAAACTAGGCAGG - Intergenic
1197732509 X:129823316-129823338 CTGGAGGGCAGCATTGAGGAAGG - Intronic
1199369873 X:147035070-147035092 CTGGTGGCCAGCATTTAAGCAGG - Intergenic
1199938585 X:152601836-152601858 CTGGGAGCCATCAGTGAGGAGGG - Intergenic
1200070109 X:153525030-153525052 CTGGGGGCCTTCACTCAGGATGG - Intronic
1200115548 X:153768289-153768311 CTGGCGGCCAGCAATGGGGCTGG - Exonic
1200148887 X:153941910-153941932 CTGGGGGCCACCCAGGAGGAGGG - Intronic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic