ID: 1081711062

View in Genome Browser
Species Human (GRCh38)
Location 11:45215723-45215745
Sequence GGTCACCTGGTCATGGCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081711062_1081711068 -10 Left 1081711062 11:45215723-45215745 CCTCTAGCCATGACCAGGTGACC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 1081711068 11:45215736-45215758 CCAGGTGACCATCTGGTGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 175
1081711062_1081711070 20 Left 1081711062 11:45215723-45215745 CCTCTAGCCATGACCAGGTGACC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 1081711070 11:45215766-45215788 ACCCAAAGCCCCTCCTAGCCCGG 0: 1
1: 0
2: 2
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081711062 Original CRISPR GGTCACCTGGTCATGGCTAG AGG (reversed) Intronic
901229412 1:7633605-7633627 GGGCACCTGGCCTTGGCTGGGGG - Intronic
903218199 1:21854634-21854656 GGTCACCTGGTACAGGCGAGGGG - Exonic
904131942 1:28281790-28281812 GGTCACCTGGCCATGGCCCAGGG - Exonic
905336620 1:37248798-37248820 GGTGACCTGAGCATGGCCAGGGG + Intergenic
910125205 1:83833081-83833103 GAACACCTGGACATTGCTAGTGG - Intergenic
914671973 1:149877732-149877754 GGTCAACTGGCAATGGCAAGTGG + Intronic
916617399 1:166456908-166456930 GGGTGCCTGGTCATGGCTACTGG - Intergenic
921049448 1:211500762-211500784 GGGAACCTGGTGATGGCTGGAGG - Intergenic
1062898903 10:1126642-1126664 GGACACCAGCTCATGGCTCGTGG + Intronic
1066332202 10:34436473-34436495 GGTCTCTTGGGCATTGCTAGTGG + Intronic
1067538554 10:47135319-47135341 GGTCAGCTGGTCCTGGGGAGGGG + Intergenic
1067714448 10:48678615-48678637 GTTCACCTGGTGATGGCTCATGG + Intergenic
1069635301 10:69921405-69921427 GGTGAGCTGGTTATAGCTAGAGG + Intronic
1070717988 10:78736396-78736418 GTTCACCTGGTCATTGGGAGAGG + Intergenic
1075099198 10:119494052-119494074 GGTGACCTGGTCAGGGCCCGTGG + Intergenic
1075948948 10:126460972-126460994 GGTCACATGGTCATGAATGGAGG - Intronic
1076980060 11:199473-199495 GGGCGCCTGGTCCTGGCTTGAGG - Exonic
1077433865 11:2528985-2529007 GTTAACCTGGTCAGGGCTGGAGG - Intronic
1081711062 11:45215723-45215745 GGTCACCTGGTCATGGCTAGAGG - Intronic
1083626846 11:64076243-64076265 GGGCACCTGGTGAGGGCTGGAGG - Intronic
1095658383 12:44698329-44698351 GGTGACCTGCTCAGGGCTAATGG + Intronic
1096873885 12:54612265-54612287 GATCACATGGTGATGGATAGTGG - Intergenic
1102055489 12:109893559-109893581 GGACACCTGGTCATGGGTCATGG - Intergenic
1113372174 13:109733888-109733910 GGTCTCCTGGCCATGGCCTGGGG - Intergenic
1113614320 13:111670191-111670213 GGTCTGATGGTGATGGCTAGAGG - Intronic
1113619788 13:111755105-111755127 GGTCTGATGGTGATGGCTAGAGG - Intergenic
1113857474 13:113455662-113455684 GGTTACCTGGCCAGGGCTGGCGG + Intergenic
1114673844 14:24428726-24428748 GGTCCCCTGGACAGGGGTAGGGG + Intronic
1116864196 14:50018113-50018135 GGATTCCTCGTCATGGCTAGTGG - Intergenic
1116911546 14:50471388-50471410 GGCCTGCAGGTCATGGCTAGGGG - Intronic
1119809773 14:77507298-77507320 GGGCACATGGCAATGGCTAGGGG + Exonic
1120445135 14:84585957-84585979 GGTCACCTGATCATCATTAGAGG - Intergenic
1124939404 15:34204075-34204097 GGTTACCTGTTGATGGTTAGAGG - Intronic
1130837312 15:87663683-87663705 GGCTACCTGCCCATGGCTAGTGG + Intergenic
1133380073 16:5322432-5322454 GGTGCCCTGGGCATGGCCAGAGG + Intergenic
1136137732 16:28267502-28267524 GGTAACATGTTCATGGCTAATGG + Intergenic
1136349071 16:29695272-29695294 GTTCACCCGGTCATGGCTGGAGG - Intronic
1137716538 16:50601726-50601748 GGTCACCTGGTGGTGGCTCCTGG - Intronic
1142020319 16:87778239-87778261 GGGGACCTGGTCAGGGCAAGGGG - Intergenic
1144673611 17:17146898-17146920 GGCCACATGGCCATGGCTTGCGG + Intronic
1144788908 17:17846805-17846827 GCACACCTGGTCCTGGCTTGTGG - Exonic
1145932254 17:28694244-28694266 TGTCATCTGGTCCTGCCTAGAGG - Intronic
1150001175 17:61441310-61441332 GGTCACATGGTCTTAGCTGGGGG + Intergenic
1151351592 17:73535101-73535123 GGTTTCCTGGTCAGGGCTATAGG - Intronic
1152408177 17:80109113-80109135 TGTCACCTGGTCCTGGAAAGTGG + Intergenic
1152658159 17:81529531-81529553 GGTCGCCTGGGCATGGCCCGAGG - Intronic
1156507776 18:37609396-37609418 GCTCAGCTGGTCATCACTAGAGG - Intergenic
1156560747 18:38122788-38122810 TGACAGCTGGTCATGACTAGGGG + Intergenic
1157090078 18:44626733-44626755 TGTATCCTGTTCATGGCTAGAGG - Intergenic
1161934370 19:7362478-7362500 GATCACCTGGTGATGGCTGTTGG + Intronic
1163182776 19:15615800-15615822 GGTCACCTGGGCCTGGTGAGTGG + Exonic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1163655919 19:18544654-18544676 GGGCACCTGGTCTTGCCTTGGGG - Intergenic
1164103011 19:22075611-22075633 GGACCCCTGGTCTTGGCTACAGG - Intronic
1167664912 19:50818370-50818392 GGGCATCTGGCCATGGCTACCGG - Intergenic
1167687146 19:50963426-50963448 GATGTCCTGGTCATGGCTGGCGG + Exonic
925139873 2:1542858-1542880 GGACACCTGGTGATGGGCAGGGG - Intronic
925632364 2:5907817-5907839 GGGCAGCTGGTCAGGGCTAAGGG - Intergenic
925742583 2:7018929-7018951 GGTCAGCCAGCCATGGCTAGTGG + Intronic
927553583 2:24017972-24017994 GCTCACCTGGTCAGGGCTGGGGG - Intronic
928213353 2:29340393-29340415 GAGCACCTGATCATGGGTAGTGG + Intronic
929558039 2:42937602-42937624 GTTGCCCTGGTCATGGCTACAGG - Intergenic
931813640 2:65878948-65878970 GCCCACCTGGTCAGGGCAAGAGG + Intergenic
938470333 2:131553890-131553912 GGTCAGGTGGCCATGACTAGAGG - Intergenic
943719800 2:191191841-191191863 GGTCACGTGTTCATGCCTGGAGG - Intergenic
948079523 2:235194166-235194188 GGCCACCAGGCCATGGGTAGTGG + Intergenic
1176058919 20:63163497-63163519 GCTCACCTGCTCAGGGGTAGGGG - Intergenic
1179578305 21:42321413-42321435 GGACCCGTGGTCCTGGCTAGGGG - Intergenic
1179670757 21:42945812-42945834 GGGGCCCTGGTCAAGGCTAGTGG - Intergenic
1179789546 21:43748622-43748644 GGTCATCTGGTGAGGGCTTGGGG - Intronic
1180967686 22:19799101-19799123 GGACACCTGGCCATGTCTTGTGG + Intronic
1183244814 22:36685538-36685560 GGTTACCAGGACATGGCCAGAGG - Intronic
956253801 3:67262720-67262742 GGCAACCTGGACATGGGTAGTGG + Intergenic
959577243 3:107947647-107947669 GGTCATATGGTCATTGCTGGGGG + Intergenic
960109143 3:113828251-113828273 GGGCACCTGGTACTGGCTATTGG - Intronic
962937074 3:140090960-140090982 GGTAGCCTGGTGATGGGTAGAGG + Intronic
968915466 4:3495362-3495384 GGTCGCCTGCCCAAGGCTAGTGG + Intronic
972388411 4:38589912-38589934 GTTCTCCTGGCCATGGCTATTGG - Intergenic
973545668 4:51979149-51979171 AGGCAGCTGGGCATGGCTAGAGG - Intergenic
984800568 4:183712346-183712368 AGTCAGCTGGTGATGGCTACAGG + Intronic
990861843 5:60335985-60336007 GGTCACTTGGTCAGGGCTCTGGG + Intronic
993603850 5:89962529-89962551 TGTCACCTGGTAATGGCTGATGG - Intergenic
995545257 5:113223724-113223746 GGTAAACTGGTCAGGGCAAGAGG + Intronic
999154415 5:149448161-149448183 AGTCACATGGCCATGGCCAGTGG - Intergenic
1001888855 5:175321978-175322000 GGTTTCCTGGTCAAGGGTAGAGG - Intergenic
1002338717 5:178500038-178500060 GGTCACCTGGGAATGGAGAGAGG + Intronic
1002700944 5:181124480-181124502 GGCCACCTTGTCATGGCTAGGGG + Exonic
1002705149 5:181155745-181155767 GGCCACCTTGTCATGGCTGGGGG - Exonic
1002842162 6:915577-915599 GGGCAGCAGGACATGGCTAGGGG - Intergenic
1006519056 6:34561068-34561090 GGTCACCTGGACAGGGCCAGAGG + Intergenic
1015657088 6:135531220-135531242 GGTCACTTGGTATTTGCTAGGGG + Intergenic
1019305956 7:335856-335878 GCTCACCTGGGCATGCTTAGGGG - Intergenic
1021386264 7:20035070-20035092 GGTCACCTGGTCATGTCTTCTGG + Intergenic
1029444841 7:100606039-100606061 GGCCACCTGGCCAGGGGTAGTGG + Intronic
1036094856 8:5712256-5712278 GGTCACGTGGTCAGGGGTATGGG + Intergenic
1036661835 8:10714126-10714148 TGTCACCAGGCCATGGCAAGGGG - Intergenic
1039364302 8:36914292-36914314 GGTCACCTTATGATGGCTGGAGG + Intronic
1039889670 8:41675771-41675793 GGTCACCTGGGAATGGTTTGGGG - Intronic
1040595473 8:48834196-48834218 GCTCTCCTGCTCATGGTTAGGGG - Intergenic
1049142003 8:140963408-140963430 GGGCAACTGGTCATGGTTAAGGG - Intronic
1051715140 9:19975054-19975076 GGTCACATGGTCATCCCTAAGGG + Intergenic
1054450480 9:65401226-65401248 TGTCTGCTGGTCATTGCTAGAGG - Intergenic
1054776427 9:69127648-69127670 GGTACCCTGGTCAGGGGTAGAGG - Intronic
1056887172 9:90454624-90454646 GGTGGCCTGGTGGTGGCTAGAGG - Intergenic
1059322641 9:113481468-113481490 GGTCCTCTGGTCATGGCCATGGG + Intronic
1060196656 9:121628446-121628468 GGGCACCTGGTCCTGGCTATGGG + Intronic
1060412990 9:123412167-123412189 GGGCGCCTGCTCAAGGCTAGAGG + Intronic
1061597440 9:131641081-131641103 AGTCACATGGTAATGGCTGGGGG - Intronic
1062045936 9:134424526-134424548 GGTCAGCTGCTCGTGGGTAGTGG - Intronic
1187890894 X:23933971-23933993 AGTGACATGATCATGGCTAGCGG - Intronic
1189200763 X:39193895-39193917 GGTCACAGGCTCATGGCCAGTGG - Intergenic
1192403798 X:70863409-70863431 GTTCACCTGGTTATCACTAGTGG - Intronic
1199237885 X:145511377-145511399 AGCCAGCTTGTCATGGCTAGAGG - Intergenic