ID: 1081711564 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:45219800-45219822 |
Sequence | CAAGCTATCCAGGCCTCCCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 167 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 15, 4: 150} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1081711564_1081711570 | 16 | Left | 1081711564 | 11:45219800-45219822 | CCAGGGGAGGCCTGGATAGCTTG | 0: 1 1: 0 2: 1 3: 15 4: 150 |
||
Right | 1081711570 | 11:45219839-45219861 | GAAATACGGTTCCCAGCAATGGG | 0: 1 1: 0 2: 0 3: 4 4: 78 |
||||
1081711564_1081711567 | 2 | Left | 1081711564 | 11:45219800-45219822 | CCAGGGGAGGCCTGGATAGCTTG | 0: 1 1: 0 2: 1 3: 15 4: 150 |
||
Right | 1081711567 | 11:45219825-45219847 | TTGGAGCTTCCTGAGAAATACGG | 0: 1 1: 0 2: 1 3: 27 4: 256 |
||||
1081711564_1081711569 | 15 | Left | 1081711564 | 11:45219800-45219822 | CCAGGGGAGGCCTGGATAGCTTG | 0: 1 1: 0 2: 1 3: 15 4: 150 |
||
Right | 1081711569 | 11:45219838-45219860 | AGAAATACGGTTCCCAGCAATGG | 0: 1 1: 0 2: 0 3: 7 4: 404 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1081711564 | Original CRISPR | CAAGCTATCCAGGCCTCCCC TGG (reversed) | Intronic | ||