ID: 1081711564

View in Genome Browser
Species Human (GRCh38)
Location 11:45219800-45219822
Sequence CAAGCTATCCAGGCCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081711564_1081711570 16 Left 1081711564 11:45219800-45219822 CCAGGGGAGGCCTGGATAGCTTG 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1081711570 11:45219839-45219861 GAAATACGGTTCCCAGCAATGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1081711564_1081711567 2 Left 1081711564 11:45219800-45219822 CCAGGGGAGGCCTGGATAGCTTG 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1081711567 11:45219825-45219847 TTGGAGCTTCCTGAGAAATACGG 0: 1
1: 0
2: 1
3: 27
4: 256
1081711564_1081711569 15 Left 1081711564 11:45219800-45219822 CCAGGGGAGGCCTGGATAGCTTG 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1081711569 11:45219838-45219860 AGAAATACGGTTCCCAGCAATGG 0: 1
1: 0
2: 0
3: 7
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081711564 Original CRISPR CAAGCTATCCAGGCCTCCCC TGG (reversed) Intronic