ID: 1081712210

View in Genome Browser
Species Human (GRCh38)
Location 11:45224627-45224649
Sequence CTGTCGGCCTTGAATGATGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081712210 Original CRISPR CTGTCGGCCTTGAATGATGA AGG (reversed) Exonic
900491023 1:2949219-2949241 CCGGCGACCTTGAATGATGGCGG - Intergenic
900791640 1:4684661-4684683 ATGTCTGTCTTGAATGATGTAGG - Intronic
900897988 1:5497237-5497259 TTGTGGCCCTTGAAGGATGAGGG - Intergenic
902499832 1:16902878-16902900 CTAACGGCATGGAATGATGAAGG + Intronic
906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG + Intergenic
915940961 1:160117901-160117923 CTCTGGGTCTTGAATGCTGAAGG - Intronic
921252793 1:213313237-213313259 CTATCTGCCTTGAAGGCTGAAGG - Intergenic
922621826 1:226994585-226994607 CTGTAGGCCTTTACAGATGATGG + Intronic
1071304837 10:84290044-84290066 CTGTCAGCCCTGAAGGATGAAGG + Intergenic
1073537021 10:104286706-104286728 CTGTCAGAATTGGATGATGAAGG - Intronic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1083553401 11:63607599-63607621 GTTTCGGTCTTGAAAGATGAGGG + Intronic
1085282661 11:75341114-75341136 CCCTCAGTCTTGAATGATGATGG + Intronic
1090349889 11:126101239-126101261 CTGTGGCCCTCGAGTGATGATGG - Intergenic
1093294195 12:17367598-17367620 CTGTACACCTTGACTGATGATGG - Intergenic
1101604583 12:106238506-106238528 CTGTCAGCTCTGAATGAGGAGGG - Exonic
1107118499 13:36773101-36773123 CTGTGGGCCTGGAATGAGTAGGG + Intergenic
1115571465 14:34670667-34670689 CTTTAGGCCTGGAAGGATGATGG - Intergenic
1117008286 14:51444628-51444650 CTGTCTGCCTTGAATGGTGATGG + Intergenic
1117269013 14:54122172-54122194 CTCACTGCCTTGAATGAAGATGG + Intergenic
1121013369 14:90534572-90534594 CTGTCGGCCTTGAGAGGTGGTGG + Exonic
1125365318 15:38907979-38908001 CAGTTGGCCTGGAGTGATGATGG - Intergenic
1131846535 15:96495160-96495182 CTGTGGGGCTGGAATCATGAGGG + Intergenic
1133202305 16:4211402-4211424 CTGTTGTCCTTCAATGATGATGG + Intronic
1138765128 16:59592802-59592824 CTGCAGGTCTTGAATAATGATGG - Intergenic
1138871322 16:60890963-60890985 CTCTTGGCTTTGAATTATGAAGG - Intergenic
1140050946 16:71480498-71480520 CTGTCAGCAATGAGTGATGATGG - Intronic
1149444721 17:56704825-56704847 CTGTGGGCCTTGAAAGAGAAAGG + Intergenic
1152012566 17:77727373-77727395 CTGAGGGGCTTGAGTGATGATGG - Intergenic
1202709440 1_KI270714v1_random:9389-9411 CTAACGGCATGGAATGATGAAGG + Intergenic
928675080 2:33642846-33642868 CAGTTGACCTTGAATGATGTGGG + Intergenic
932774936 2:74522708-74522730 CTGGCAGCCCTGGATGATGATGG - Exonic
935128981 2:100247338-100247360 ATGTGGCCCTGGAATGATGAAGG + Intergenic
935251265 2:101263564-101263586 CTGTGTGCTTTGAATTATGAAGG + Intronic
942771374 2:179524998-179525020 ATGTCTGCCTCGAGTGATGATGG - Intronic
944656950 2:201885006-201885028 GAGTGGGCCTTGAAAGATGATGG + Intronic
944668087 2:201973124-201973146 CTGGCTGCCCTGAATGCTGACGG - Intergenic
1169248036 20:4039108-4039130 CTGTGGGCCTGGAATCATGCAGG + Intergenic
1169332185 20:4724724-4724746 CTTGCGGCCTTGCTTGATGAAGG - Exonic
1174107604 20:48173848-48173870 CTGTCTGCCTTGGATAATCAGGG - Intergenic
1181531069 22:23517808-23517830 CTGGCGGCCTTGGCTGAGGAAGG + Intergenic
1185150892 22:49163485-49163507 ATGCCCGCCTTGAATGATGGCGG - Intergenic
955338878 3:58109432-58109454 TGGTGGGCCTTGAATGATGGAGG + Intronic
959374485 3:105571693-105571715 CTGTGAGCCTTGACTGATAATGG - Intronic
960357280 3:116669197-116669219 CTTTCTCCCTTGAAGGATGAAGG + Intronic
968359851 3:198139214-198139236 CTGCCGGCCTTCAGTGCTGATGG - Intergenic
970180170 4:13383837-13383859 CTGTCAGACCTGAATGATGCAGG + Intronic
971203725 4:24540236-24540258 CTGGCTGCTTTAAATGATGATGG - Exonic
971427814 4:26533355-26533377 CTGTCTTCCTTCCATGATGATGG + Intergenic
973698628 4:53515208-53515230 CTGGCGGCCTTAAGTGATGTGGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
981568422 4:146125792-146125814 CTTACAGCCTTGAATGATAAAGG - Intergenic
986073407 5:4310226-4310248 CTTTAAACCTTGAATGATGAAGG - Intergenic
991254149 5:64596311-64596333 CTGTCTGCCTTGAGAGATCATGG + Intronic
992818325 5:80467403-80467425 CTGCCTGACTTGAATGTTGAAGG + Intronic
1007932264 6:45702314-45702336 CTGTCCGCCTTGAGTGATCAGGG + Intergenic
1009588050 6:65631410-65631432 CTTTGGTCCTTGAATGAGGATGG + Intronic
1026373246 7:69723144-69723166 CTGGCTGCTGTGAATGATGAAGG - Intronic
1035073075 7:156158967-156158989 CTGGGGGCCTGGAAAGATGAGGG - Intergenic
1035669786 8:1408501-1408523 CTCTGGGCCTTGGATGATGAGGG + Intergenic
1036818009 8:11916444-11916466 CTCTCCGCCTTGAAATATGAAGG - Intergenic
1040948833 8:52915308-52915330 CAGTTGGCCAAGAATGATGATGG + Intergenic
1041206862 8:55508605-55508627 TTGTCAGCCTGGAAGGATGATGG + Intronic
1042223314 8:66494494-66494516 TTGTCAGCCTTGAATGAAGTAGG + Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055339772 9:75268790-75268812 CAGACGGCCTTGACTTATGATGG + Intergenic
1055441252 9:76338648-76338670 CTCTGGGCCTTGAAGGATGGGGG - Intronic
1055571334 9:77620123-77620145 CTATCTGCCTTGAATGATCAAGG + Intronic
1056746840 9:89310763-89310785 CTGTCGACCTTGCACGGTGATGG - Intergenic
1186467750 X:9797252-9797274 CTGGCTGCCTGGAATGAAGATGG + Intronic
1186944759 X:14553496-14553518 CTTTCTGCCTTGATAGATGATGG + Intronic
1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG + Intergenic
1190200214 X:48354919-48354941 CTGTCGGGCTTTAATGCTGCTGG + Intronic
1199357586 X:146879774-146879796 ATGTAGGCCTTATATGATGATGG + Intergenic