ID: 1081713679

View in Genome Browser
Species Human (GRCh38)
Location 11:45233917-45233939
Sequence GGGCCACGGGGCCTCTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081713679_1081713687 1 Left 1081713679 11:45233917-45233939 CCCTCACAGAGGCCCCGTGGCCC 0: 1
1: 0
2: 1
3: 9
4: 204
Right 1081713687 11:45233941-45233963 TACCCCACTCCCGCCGTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1081713679_1081713691 5 Left 1081713679 11:45233917-45233939 CCCTCACAGAGGCCCCGTGGCCC 0: 1
1: 0
2: 1
3: 9
4: 204
Right 1081713691 11:45233945-45233967 CCACTCCCGCCGTAACAGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081713679 Original CRISPR GGGCCACGGGGCCTCTGTGA GGG (reversed) Intronic
900416904 1:2539533-2539555 CTGCCCCGGGGCCTCTGGGAAGG - Intergenic
900502188 1:3011758-3011780 GGGCCGCCTGGCCTCTGTCACGG - Intergenic
900616163 1:3566611-3566633 GGGCCCCGGGGTCCCTCTGATGG - Intronic
900924214 1:5692822-5692844 GGGCCACGGGGCTACTGCTAGGG - Intergenic
901034605 1:6328857-6328879 GGCCCTCGGGGCCTGTGTGCTGG + Intronic
901130422 1:6959333-6959355 AGGACACGGGGACACTGTGAGGG + Intronic
902527927 1:17071361-17071383 GGGCCAGAGGGCCCCTGGGAGGG - Intronic
903649298 1:24913322-24913344 GGGCCACTGGGCCCTTGGGAGGG - Intronic
903838995 1:26225137-26225159 GGCCAACGGGGCCTCTCTGGAGG + Intergenic
903865188 1:26392689-26392711 GGAGCACGGGGGTTCTGTGAGGG + Intergenic
905519173 1:38584825-38584847 GGGCCAGGAGGCCTATGTGTTGG - Intergenic
905870249 1:41399441-41399463 GGGGCACGGGGGGTCTGCGATGG - Intergenic
915269845 1:154746271-154746293 GGGGCACGGGGCCACTGCGCAGG + Intronic
916716970 1:167454922-167454944 GGGCCACAGGGACTCTGAGGAGG - Intronic
920847088 1:209603311-209603333 GCCCCACCAGGCCTCTGTGAAGG - Intronic
922898752 1:229120418-229120440 GCGCCACGGGGGCACTCTGAGGG + Intergenic
924588551 1:245381170-245381192 AGGCCACGGGTCCTTTCTGAAGG - Intronic
1062802217 10:389003-389025 GGGCCACGGGGATTCTCTGGGGG + Intronic
1062971380 10:1651806-1651828 GGGGCCCTGGGCCTGTGTGATGG - Intronic
1066083511 10:31955344-31955366 GGCCCATGGGGACTCTGTGTGGG - Intergenic
1067697064 10:48543059-48543081 GGGCCCCTGGGTGTCTGTGAGGG + Intronic
1071901866 10:90129064-90129086 GGGCCTTGGGGCCTCAGAGATGG - Intergenic
1074248115 10:111714467-111714489 TGCCCTCGGGGCCACTGTGATGG - Intergenic
1074753320 10:116607458-116607480 GGGCCGCGGGGAGGCTGTGATGG + Intronic
1075720894 10:124586693-124586715 TCGCCTCGGGGCCTCTGTGCAGG - Intronic
1076294734 10:129375557-129375579 GGGCCACTGGGCCCTTGTCAGGG + Intergenic
1076761657 10:132608843-132608865 GGCCCAGGGGCCCTCTGTGAGGG + Intronic
1076843348 10:133057270-133057292 GGGCCGTGGGGCCCCTGTGCTGG - Intergenic
1076889186 10:133275635-133275657 GGCCCAGGAGGCCTCTGGGAAGG - Intronic
1077023718 11:430692-430714 GGGCGTGGGGGCATCTGTGAGGG + Intronic
1077273368 11:1692141-1692163 GGGCCTCTGTCCCTCTGTGAAGG - Intergenic
1077328708 11:1974642-1974664 GGGCCTCGGGGCCTTGGAGAGGG + Intronic
1077424594 11:2468569-2468591 GGGACAGGGGGACGCTGTGAGGG - Intronic
1079094140 11:17500213-17500235 GGGCCTCTGGCCCTCTGGGAAGG + Intronic
1079345949 11:19652386-19652408 GGGCCAAGGGTCAGCTGTGAGGG + Intronic
1081664429 11:44908300-44908322 GGCCCAAGAGGCCTGTGTGAGGG - Intronic
1081713679 11:45233917-45233939 GGGCCACGGGGCCTCTGTGAGGG - Intronic
1083202239 11:61127551-61127573 TGGCCACGGGGGCTCTCAGAAGG - Exonic
1084572546 11:69968289-69968311 GGCCCAAGGGGTCTCTGGGAAGG - Intergenic
1084890766 11:72235866-72235888 CGGGCAGGAGGCCTCTGTGAAGG - Exonic
1085502908 11:77039283-77039305 AGTCCACTGGGCCTATGTGACGG + Intronic
1085756804 11:79208633-79208655 GGGCCACAGAGCCTCAGAGAGGG - Intronic
1088881617 11:113977435-113977457 GGCCCACGGGGCCTAAGCGAGGG - Intronic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1089433058 11:118437883-118437905 GGGGAAGGGGGCCCCTGTGAGGG + Intronic
1089604708 11:119635206-119635228 GGGCCAAGGCCCCTCTGTGTGGG - Intronic
1090660055 11:128875726-128875748 AGGCCACAGGGCCTGTGTGGAGG - Intergenic
1202811687 11_KI270721v1_random:29821-29843 GGGCCTCGGGGCCTTGGAGAGGG + Intergenic
1091453428 12:587668-587690 CTGCCCCGGGGCCTCTGTGCAGG + Intronic
1091545891 12:1501051-1501073 AGGCCCAGAGGCCTCTGTGAGGG - Intergenic
1092879639 12:12878050-12878072 GGGCCAGAGGGCCTCTCTGGAGG + Intergenic
1097947677 12:65389803-65389825 GGGCCATGCAGCCTGTGTGAAGG - Intronic
1103321335 12:120094206-120094228 GGGCCGCGGAGCCTCTGAGTTGG - Exonic
1104672232 12:130688718-130688740 GGGCCATGTGGCCTCTGTTTTGG - Intronic
1104963261 12:132498081-132498103 GGCCCACAGGGCCTCTGGGGAGG + Intronic
1106022434 13:25928191-25928213 TGGCCAGGGGGCCTGTGTTAGGG + Intronic
1106459260 13:29954495-29954517 AGGACACGGGGCTTCTGCGATGG + Intergenic
1114552138 14:23538800-23538822 AGGGCTGGGGGCCTCTGTGAAGG + Intronic
1118389951 14:65287570-65287592 GGGCCCAGGGGCCTCTGAGCTGG + Intergenic
1119480541 14:74955351-74955373 GGGCCTCGGGGCAGCAGTGAGGG - Exonic
1119650558 14:76380042-76380064 GGGCCAGGGGTGCTCTGAGAAGG - Intronic
1119793549 14:77376401-77376423 AGGCCAGGGGGCCTATGTGCAGG + Intronic
1122198557 14:100108117-100108139 GGGCCACTGGGCATCAATGAAGG - Intronic
1123106955 14:105846144-105846166 GGGCCATGGGGTCCCTGTGGAGG + Intergenic
1123123509 14:105928946-105928968 GGGCCTCAGGTTCTCTGTGAGGG + Intronic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1125233488 15:37484336-37484358 ATGCCTCTGGGCCTCTGTGATGG + Intergenic
1125402205 15:39316289-39316311 GGGCCACAGGGCCTTTCTCATGG + Intergenic
1125508802 15:40282073-40282095 CGGCCACGGGACCTGTGTGCAGG - Exonic
1127325007 15:57886347-57886369 GGGCCAAAGGGCTTCTGTCAAGG + Intergenic
1128253555 15:66180465-66180487 GGGCTCCTGGGTCTCTGTGAAGG - Intronic
1128659171 15:69485210-69485232 GGGCCACTGGGGTTCAGTGAAGG + Intergenic
1132251795 15:100340700-100340722 GGGCCAAGGCGCCTCTGTCCAGG + Intronic
1132733720 16:1375498-1375520 GGGCCCTGCTGCCTCTGTGACGG - Intronic
1132751038 16:1457859-1457881 GGGACACGGGGCCTCCGGGAGGG + Intronic
1133076323 16:3283608-3283630 GGGCCACGGGGCCGGCGTGGCGG + Exonic
1134046234 16:11103210-11103232 GCGCCACTGGGCCTCTCTGGGGG - Intronic
1136396729 16:29996499-29996521 GGGCCAACGGTCCTCCGTGAAGG - Intronic
1136619102 16:31416234-31416256 GGGCAAGATGGCCTCTGTGAAGG + Exonic
1137024245 16:35457050-35457072 GGGCCAGGGGGTCTTTCTGAGGG + Intergenic
1138096283 16:54214434-54214456 GGGCCCCGTGGGCTCTGGGATGG + Intergenic
1141665420 16:85463038-85463060 GGGACCCGGGGCCTCTAGGAGGG - Intergenic
1141712014 16:85705191-85705213 GTGCCATGGGGCCTCTGGGGAGG - Intronic
1142978546 17:3658881-3658903 GGGACACGGGGCGGCAGTGAGGG + Intronic
1143202767 17:5123402-5123424 GCGCGGCGGGGCCTCCGTGAAGG + Intronic
1143874280 17:9980010-9980032 GGGACATGGGGCAGCTGTGACGG - Intronic
1145031468 17:19507816-19507838 GGGCCATGGGGATTCTGGGAGGG - Intronic
1145787428 17:27603292-27603314 AGGGCTCGGGGCCTCTGTGCTGG + Intronic
1147966996 17:44199240-44199262 GGGGCGCGGGGCCTTTGTTAGGG - Intronic
1148094211 17:45041209-45041231 GGGCCTGGAGACCTCTGTGAAGG - Intronic
1148150667 17:45395040-45395062 GGCCCACAGGGTCTCTGTGAAGG + Exonic
1148794480 17:50190474-50190496 GGGCCAGGGGTGCTGTGTGAAGG + Intronic
1150613082 17:66749217-66749239 GGGTCTTGGGGCCCCTGTGAAGG - Intronic
1151323796 17:73366742-73366764 TGTCCACGGGGCTTCTGGGAGGG + Intronic
1151365199 17:73612379-73612401 GGGCCACAGGGACCCGGTGAGGG - Intronic
1152237224 17:79144853-79144875 GGGCCAGGAGACATCTGTGAAGG - Intronic
1153707087 18:7757051-7757073 GGGCCACCTGTCCTCTGTTAAGG + Intronic
1156090091 18:33456479-33456501 GGGCGACAGGGCATCTGAGATGG + Intergenic
1160841221 19:1147778-1147800 GGGTCAAGGGGCCTGTGTGTGGG - Intronic
1160990488 19:1858364-1858386 GGGGCACCAGGCCACTGTGAGGG - Intronic
1161007539 19:1944023-1944045 GGGACACAGGGCCCATGTGAAGG + Intronic
1162274943 19:9645657-9645679 GTGTCACTGGGCCTCTGTCAAGG + Intronic
1163234331 19:16022274-16022296 GGGACCCAGGGCCTCTGGGAAGG - Intergenic
1163659688 19:18569235-18569257 GGGCCAGCAGGCCTCTCTGAAGG + Exonic
1163685869 19:18711321-18711343 CGGCCCCGGGGCCGCTTTGAAGG + Intronic
1163699690 19:18781089-18781111 GGGCCCCTCGGCCTCTGAGACGG - Exonic
1164509809 19:28888309-28888331 GAGCCAGGGGTCCTGTGTGAGGG - Intergenic
1166996788 19:46723234-46723256 GGGCCACGGGGACGCCGTGTGGG - Exonic
1167001174 19:46746424-46746446 CGGCCCCGGGGCCTCCATGATGG - Exonic
1167660702 19:50794484-50794506 GGGGCCCTGGGCCTCTATGATGG + Exonic
1168412043 19:56146379-56146401 GGGCAAAGAGGTCTCTGTGAGGG - Exonic
925399590 2:3562661-3562683 GGGCAACGGGGCCTACCTGAGGG - Intergenic
927507924 2:23626698-23626720 GGGCGGCGGGGCCTCTGAGTAGG - Intronic
927508385 2:23629074-23629096 GGGCGGCGGGGCCTCTGAGCAGG + Intronic
927639881 2:24839768-24839790 GGGACAGGGGGCCTCAGAGAAGG - Intronic
928604847 2:32936120-32936142 GGGCCACTGGGGCTGTGTCATGG + Intergenic
934852664 2:97711330-97711352 GGGACAGGGTGCCTCTGTGTGGG - Intergenic
937327556 2:121000464-121000486 GGGACACAGGACCACTGTGATGG - Intergenic
938080601 2:128367986-128368008 AGCCCACGGGGGCACTGTGAGGG + Intergenic
943129726 2:183840266-183840288 GGGCAAAAGGGACTCTGTGAGGG - Intergenic
946831776 2:223735107-223735129 GGGCCACTTGCCCTCTCTGAAGG + Intergenic
948974945 2:241458266-241458288 AGGCCATGGGGCCTCTAGGAGGG + Intronic
948997852 2:241592857-241592879 GGGCCACGGGACGTCTGTACGGG + Intronic
949025142 2:241764200-241764222 GGGCGACGGGGACTGTGGGAGGG + Intronic
1174342348 20:49905891-49905913 GGCCCACGGGGCATCTCTGCGGG - Exonic
1175084334 20:56445974-56445996 GGACCACGGGGCCCCGGTGCTGG - Exonic
1175261447 20:57676759-57676781 TGGCCACAGGGTCTCTGTGTGGG - Intronic
1175763584 20:61577965-61577987 GGGACAGGGGGCCTCAGGGAAGG - Intronic
1175913248 20:62414423-62414445 GGGCCAGGGGGCTGCTGTGGGGG + Exonic
1175922680 20:62457444-62457466 GGTCCCCGGGGCCTGTGTGTGGG - Intergenic
1175922692 20:62457468-62457490 GGTCCCCGGGGCCTGTGTGAGGG - Intergenic
1175999511 20:62825677-62825699 GGGCCTTGGAGGCTCTGTGAAGG - Intronic
1176052469 20:63127372-63127394 GGCACACGGTGCCTCTGTGTGGG - Intergenic
1176656361 21:9591804-9591826 GAGCCAGGGAGCCTCTCTGAAGG + Intergenic
1179975206 21:44861535-44861557 AGGCCACGGGGCCTCTGTGTTGG + Intronic
1180947354 22:19703917-19703939 GGACCACGGGGCCTCAGAGAAGG - Intergenic
1181116472 22:20635178-20635200 GGGCCTCAGGGTCACTGTGAGGG - Intergenic
1183301525 22:37061318-37061340 GGGCCAGGGGGCCTGGGTGGAGG - Intronic
1183409127 22:37644764-37644786 GGGCCACTGGGGCTCTAAGATGG + Intronic
1183625149 22:38997282-38997304 GGGCCTGGGGCCCTCTGGGAGGG + Intergenic
1185295252 22:50049878-50049900 AGGCCACAGGGACTCTGAGAAGG + Intronic
1185388881 22:50548488-50548510 GGGCCAGGCGGCCTCTGCGCGGG - Exonic
950358064 3:12428428-12428450 GGGCCAAGGGTCCTCTCTGCTGG - Intronic
953576117 3:44114364-44114386 GAGCCGAGGGTCCTCTGTGACGG - Intergenic
953904460 3:46861524-46861546 GGGCTTAGGGGGCTCTGTGAGGG - Intronic
956901962 3:73726222-73726244 GGGAAACTGGGGCTCTGTGAGGG + Intergenic
965535527 3:169820110-169820132 TAGGCACTGGGCCTCTGTGATGG + Intergenic
966861561 3:184233534-184233556 GGGTCACTGGGCCACTGTGAAGG - Intronic
968554961 4:1242191-1242213 GGGGCAGGGGGCCCCTGAGAGGG + Intronic
968603671 4:1521492-1521514 GGGCCACGGGGCCCCGGCGGGGG - Intergenic
968846171 4:3042777-3042799 CAGCCACAGGGCCTCTGTAAAGG + Intergenic
969428104 4:7137740-7137762 GGGCCACCCTGCCTCAGTGAGGG + Intergenic
969608518 4:8214241-8214263 GGGCCACGTGAGCTCTGGGAAGG + Intronic
969616476 4:8255846-8255868 GGGGCACGGGGCCACAGAGAAGG + Intergenic
969659356 4:8517566-8517588 GAGCCACGTGGCCTGTGTGCAGG - Intergenic
969708883 4:8831492-8831514 AGGCCACTGGGCCTGTGTGGAGG - Intergenic
973719486 4:53708568-53708590 TGGCCACCTGGCCACTGTGAAGG + Intronic
984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG + Intronic
985589084 5:755515-755537 GGCCCTGGAGGCCTCTGTGATGG - Intronic
985603763 5:848031-848053 GGCCCTGGAGGCCTCTGTGATGG - Intronic
992206373 5:74434232-74434254 GGGCTGCAGGGCCTCAGTGATGG - Intergenic
997200522 5:132007351-132007373 AGGCCAAGGGACCTGTGTGAGGG - Intronic
999318895 5:150601238-150601260 GGGCCTCGGGGTCCCTGGGATGG + Intronic
999622294 5:153485635-153485657 GGCCCAGGTGGCCTCTCTGAAGG + Intergenic
1001581072 5:172798882-172798904 GGGCCAGGGGGCATCTGTCCGGG + Intergenic
1002204428 5:177553436-177553458 GGGCCACGGTTGCTCTGGGAGGG - Intronic
1002428809 5:179191392-179191414 GGGCCACACAGCCTCTGAGACGG - Intronic
1002701178 5:181126113-181126135 GGGCCAAGGGGCTTTTCTGATGG - Intergenic
1002782933 6:380675-380697 AGGACACGGAGCCACTGTGAGGG - Intergenic
1003421426 6:5961599-5961621 GGAACACGAGGCCCCTGTGATGG - Intergenic
1004516656 6:16327161-16327183 GGGGGTCCGGGCCTCTGTGATGG - Exonic
1006163777 6:32052938-32052960 GGGCTCCGGGGCCTCCGTGCTGG + Intronic
1013460224 6:110367430-110367452 GGGCCACGGGGAGTCACTGATGG + Intergenic
1014137764 6:117907979-117908001 GGCCCACGGGTCCTTTGGGACGG + Intronic
1016356795 6:143227353-143227375 GGGGCACGGGGCAGCTGTAATGG - Intronic
1018013713 6:159693702-159693724 CGGCCACGGGGGCCCTGGGAGGG - Intronic
1018025236 6:159800468-159800490 AGGCCACAGGGCCTCAGAGAGGG + Intronic
1018176739 6:161183945-161183967 GTGCCAAGGGGCCTCTGAAAGGG + Intronic
1018685084 6:166298050-166298072 GGGCCATGGGTCCCCTGTGCTGG - Intergenic
1019274278 7:167592-167614 GGGCCTCGGGGGCTCTGACACGG - Intergenic
1020162247 7:5781471-5781493 AGGCGACGCGGCCTCTCTGAGGG - Intronic
1022606860 7:31823973-31823995 GGGCCATGGGGACTCTGGCAGGG + Intronic
1023691197 7:42789867-42789889 GGGCCACGGGTTTTCTGTGGTGG - Intergenic
1024573894 7:50748249-50748271 GGGCCACGGGGCCTCCTCCAGGG - Intronic
1024658988 7:51475461-51475483 GGGACACAGTGCCTCTATGATGG + Intergenic
1030563364 7:111119861-111119883 GAGCCATGGGACCACTGTGAAGG + Intronic
1032543550 7:132724119-132724141 GGGCCTCAGGGCTTCTGGGAAGG - Intronic
1032695036 7:134328178-134328200 GAGCCAGCGTGCCTCTGTGAAGG + Intergenic
1034514300 7:151562287-151562309 GGGCCACGGCAGCTCTGTGCCGG + Intronic
1034938237 7:155213536-155213558 GGGCCTCTGGGCCTCCATGAGGG - Intergenic
1035336992 7:158136073-158136095 TGCCCACGGGGGCTCTGGGATGG + Intronic
1035637204 8:1155985-1156007 GGCCCACAGGCCCTCTGCGACGG - Intergenic
1035648904 8:1249266-1249288 GGGCCACTGGGCCTCTCTGTGGG + Intergenic
1037975168 8:23204059-23204081 GAGCCACCGTGCCACTGTGAAGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1038612837 8:29070657-29070679 GGGCCACGGGCCCTGTGCGGCGG - Exonic
1040288580 8:46112796-46112818 GGCCCTGGGGGCCTCTGGGATGG + Intergenic
1043131079 8:76462018-76462040 GGTCCCCAGGGCTTCTGTGAAGG + Intergenic
1056605144 9:88079189-88079211 GGTCCATGGGGCCTCAGGGAAGG - Intergenic
1057817764 9:98308209-98308231 GGGCCACCAAGCCACTGTGAAGG + Intronic
1058876821 9:109251888-109251910 GGGCCTCGGGGACGCCGTGAGGG + Intronic
1059427329 9:114229376-114229398 GGGCCAAGGGGACTATGTGATGG - Intronic
1059427469 9:114230231-114230253 GGGCCACGGGGCCTGTGCAGTGG + Intronic
1060719775 9:125969149-125969171 GGGCCAGAGAGCCTGTGTGATGG - Intergenic
1061161662 9:128898996-128899018 GGGACAAGGGGTGTCTGTGATGG + Intronic
1061961218 9:133990297-133990319 GGCTCAAGGGGCCTCTGTCAGGG + Intronic
1061970912 9:134045051-134045073 GGACCACTGGGGCTCTGTGGGGG - Intronic
1203634078 Un_KI270750v1:95286-95308 GAGCCAGGGAGCCTCTCTGAAGG + Intergenic
1189363911 X:40373651-40373673 GAGGGACAGGGCCTCTGTGATGG + Intergenic
1192144921 X:68675646-68675668 GAGCCCCCGGGCCTCTGGGATGG + Intronic
1194288868 X:92043553-92043575 GGGCCACTGGTCCTTGGTGATGG + Intronic
1195245523 X:102991895-102991917 GGGCCACTGGGCATCCTTGATGG - Intergenic
1200097375 X:153670513-153670535 GGGCGAGGGGGCCTCTGAGCAGG - Exonic
1200606388 Y:5268120-5268142 GGGCCACTGGTCCTTGGTGATGG + Intronic
1201571655 Y:15421836-15421858 GGGCCACAGAACTTCTGTGAAGG + Intergenic