ID: 1081714546

View in Genome Browser
Species Human (GRCh38)
Location 11:45239530-45239552
Sequence CAGGAGTTCATGAGTACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081714540_1081714546 -4 Left 1081714540 11:45239511-45239533 CCTTGTCCCTGCTTGCCACCAGG No data
Right 1081714546 11:45239530-45239552 CAGGAGTTCATGAGTACCACTGG No data
1081714542_1081714546 -10 Left 1081714542 11:45239517-45239539 CCCTGCTTGCCACCAGGAGTTCA No data
Right 1081714546 11:45239530-45239552 CAGGAGTTCATGAGTACCACTGG No data
1081714539_1081714546 -3 Left 1081714539 11:45239510-45239532 CCCTTGTCCCTGCTTGCCACCAG No data
Right 1081714546 11:45239530-45239552 CAGGAGTTCATGAGTACCACTGG No data
1081714538_1081714546 6 Left 1081714538 11:45239501-45239523 CCAGGAGTGCCCTTGTCCCTGCT No data
Right 1081714546 11:45239530-45239552 CAGGAGTTCATGAGTACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081714546 Original CRISPR CAGGAGTTCATGAGTACCAC TGG Intergenic
No off target data available for this crispr