ID: 1081718782

View in Genome Browser
Species Human (GRCh38)
Location 11:45271012-45271034
Sequence GATGGTAAACTCTCTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081718782_1081718789 7 Left 1081718782 11:45271012-45271034 CCACCCTCAGAGAGTTTACCATC 0: 1
1: 0
2: 1
3: 24
4: 171
Right 1081718789 11:45271042-45271064 AGAGATGAGATATTCCATAAAGG 0: 1
1: 0
2: 2
3: 46
4: 382
1081718782_1081718791 9 Left 1081718782 11:45271012-45271034 CCACCCTCAGAGAGTTTACCATC 0: 1
1: 0
2: 1
3: 24
4: 171
Right 1081718791 11:45271044-45271066 AGATGAGATATTCCATAAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 225
1081718782_1081718790 8 Left 1081718782 11:45271012-45271034 CCACCCTCAGAGAGTTTACCATC 0: 1
1: 0
2: 1
3: 24
4: 171
Right 1081718790 11:45271043-45271065 GAGATGAGATATTCCATAAAGGG 0: 1
1: 0
2: 0
3: 24
4: 268
1081718782_1081718792 19 Left 1081718782 11:45271012-45271034 CCACCCTCAGAGAGTTTACCATC 0: 1
1: 0
2: 1
3: 24
4: 171
Right 1081718792 11:45271054-45271076 TTCCATAAAGGGGAGATACTAGG 0: 1
1: 0
2: 1
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081718782 Original CRISPR GATGGTAAACTCTCTGAGGG TGG (reversed) Intronic
900989148 1:6090105-6090127 GAGGGTATATTGTCTGAGGGAGG + Intronic
901359024 1:8679612-8679634 GTTGGGAAATCCTCTGAGGGAGG - Intronic
902797029 1:18806689-18806711 GAAGGTAAGCTCCGTGAGGGAGG - Intergenic
903839076 1:26225485-26225507 GATGGTGAACTCACTTGGGGCGG + Intergenic
905392914 1:37649735-37649757 GAAGGTAAACTCCATGAGGGCGG - Intergenic
905528095 1:38654765-38654787 GAATGTAAGCTGTCTGAGGGCGG - Intergenic
905971971 1:42148701-42148723 ATGGGGAAACTCTCTGAGGGAGG + Intergenic
906257770 1:44363615-44363637 GAATGTAAGCTCTATGAGGGCGG - Intergenic
906759172 1:48357869-48357891 GTTGGTATACTCTCTGGGGCAGG - Intronic
907702019 1:56797895-56797917 GAATGTAAACTCTTTGAAGGTGG + Intronic
908465724 1:64391995-64392017 GATGGTAAGCTCATTGAGGCAGG + Intergenic
911822269 1:102437100-102437122 GATGGGAAGCTCTCCAAGGGAGG + Intergenic
911864662 1:103002566-103002588 GAGGGAAAACTGTTTGAGGGTGG - Intronic
912578164 1:110694444-110694466 TATGGCAACCTCTCTGAGGGTGG - Intergenic
912715973 1:111983759-111983781 TCTGGAAAAATCTCTGAGGGTGG - Intronic
920513233 1:206565991-206566013 GATGGTAAACTAACTTAGGATGG - Intronic
920612882 1:207458837-207458859 GATTATAAATTCTATGAGGGTGG + Intronic
920868610 1:209774334-209774356 GATTGTAAACTCCTTCAGGGAGG - Intronic
924501234 1:244639772-244639794 AAAGGTAAACACTGTGAGGGTGG + Intronic
1071512346 10:86269974-86269996 GATGTTTAATTCTGTGAGGGAGG - Intronic
1072986923 10:100149024-100149046 AATGCTAATCTCTCTGAGGGCGG - Intergenic
1073564570 10:104524163-104524185 GATTGTAAATTCCTTGAGGGTGG + Intergenic
1074021253 10:109586426-109586448 AATGGTGAACTCAGTGAGGGAGG + Intergenic
1074049017 10:109865975-109865997 GATGGCAAAAGCTCTGAGGCAGG + Intronic
1074199817 10:111224742-111224764 GATGGTAAAGTCCCAGGGGGTGG - Intergenic
1074921249 10:118016140-118016162 CATGGGAAACTCTCTGGAGGTGG - Intronic
1076417934 10:130305165-130305187 GATGGTGAACTCACTGAGCCAGG + Intergenic
1077421737 11:2453665-2453687 GAGGGTAGACTCTGTGAGGAAGG + Intronic
1077727870 11:4693871-4693893 GATTATAAACTCTCTAAGTGGGG - Intronic
1079079601 11:17405109-17405131 CAAGGTAAACTCCCTGAGGTAGG + Intronic
1080506310 11:32917399-32917421 GATGTTTAACTTTTTGAGGGAGG + Intronic
1080607572 11:33876312-33876334 GAATGTAAACTCTGTGAGGGTGG + Intronic
1080740347 11:35058051-35058073 GATGAGAAACACTATGAGGGAGG + Intergenic
1081117076 11:39216920-39216942 GAAGTTCAACTCTCTGAGGCAGG + Intergenic
1081366348 11:42239951-42239973 GATGGCAATGTCTCTGGGGGTGG + Intergenic
1081416613 11:42822867-42822889 GAGGATCAGCTCTCTGAGGGAGG - Intergenic
1081718782 11:45271012-45271034 GATGGTAAACTCTCTGAGGGTGG - Intronic
1082820651 11:57542655-57542677 GAAGGGAAGCTCTCTGAGGATGG + Exonic
1084196060 11:67524068-67524090 AATGGGAGACTCTCTGAGGTCGG - Intergenic
1086332363 11:85766702-85766724 GAATCTAAACTCTCTGAGGCAGG - Intronic
1087269788 11:96099512-96099534 GATTTTAAGCTCTTTGAGGGTGG + Intronic
1089269464 11:117291660-117291682 GATGGTACAGTGTCAGAGGGAGG - Intronic
1090337666 11:125984147-125984169 AATGGTTTACTCTCTGAAGGAGG + Intronic
1091229069 11:133976100-133976122 GATGGTGATCTGTCTTAGGGTGG + Intergenic
1094366579 12:29689188-29689210 GGTGGTACACACTCTGAGGTTGG - Intronic
1095894568 12:47267480-47267502 AATGTTAAAGTCTCTGAAGGAGG + Intergenic
1097351314 12:58552261-58552283 GATTGTAAACTGTCTGGGTGAGG - Intronic
1097668052 12:62504035-62504057 GAAGATAAACTCTATGAGGCAGG + Intronic
1098524681 12:71473117-71473139 GATTGTAATCTCTTTGAGGGTGG - Intronic
1101087882 12:101254785-101254807 GCTGGTAAACTGGCTCAGGGAGG + Intergenic
1102278684 12:111601145-111601167 GAGGGCAAAGGCTCTGAGGGGGG + Intergenic
1105699976 13:22928230-22928252 GATGGGACACTCCCTGAGGTGGG + Intergenic
1105852780 13:24350414-24350436 GATGGGACACTCCCTGAGGTGGG + Intergenic
1107566091 13:41606146-41606168 GAGAGCAAATTCTCTGAGGGAGG - Intronic
1108695085 13:52896038-52896060 GATGGTGAACACTCTGATGCAGG - Intergenic
1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG + Intergenic
1109956276 13:69571079-69571101 GATGGTTACTTCTCTGAGGATGG + Intergenic
1110051950 13:70913326-70913348 AATGTTAAACTCTCTAAGAGGGG + Intergenic
1110399683 13:75075444-75075466 TATCATAAACTCTCTGAGAGCGG - Intergenic
1111128045 13:83937176-83937198 TATTGTGAGCTCTCTGAGGGAGG + Intergenic
1115307047 14:31944308-31944330 CATGGTAAACACTTGGAGGGAGG - Intergenic
1117207855 14:53463215-53463237 GAAGGCAAACTCTTTGAGAGTGG - Intergenic
1118896228 14:69947995-69948017 AATGGTAATCTCACTGAGGGTGG + Intronic
1119189006 14:72666598-72666620 GATGCTTAACTCTATGAGGTAGG - Intronic
1121465023 14:94110254-94110276 GCTGGTAAACTCTGTGAGGATGG + Intronic
1122375260 14:101252976-101252998 GATGCTACACTCTCAGAAGGAGG - Intergenic
1124642362 15:31403823-31403845 GGCTGTAAACTCTCTGAGGGTGG - Intronic
1125525543 15:40371820-40371842 GAAGGTGAGCTCTTTGAGGGTGG - Intergenic
1127038018 15:54941224-54941246 TGTGGTAAACTCCCTGAGTGAGG - Intergenic
1127825136 15:62696334-62696356 GAAGGTAAAAAGTCTGAGGGTGG - Intronic
1128801485 15:70499893-70499915 GATGGGAACCTATTTGAGGGTGG - Intergenic
1130624791 15:85503242-85503264 GATTGTAAACTCTAAGAGGATGG - Intronic
1131779237 15:95838420-95838442 GATGGTAAGCTCCTTGAGGATGG - Intergenic
1132684501 16:1156645-1156667 GAGGGTGAACTCTGAGAGGGAGG + Intronic
1132818929 16:1851477-1851499 GAGGGTAAACTCCATGAGGGTGG + Intronic
1133522526 16:6573151-6573173 GATGGTAAAGTCTCTGGTAGTGG - Intronic
1135230868 16:20706588-20706610 GGTGGTAAACTCATTGATGGTGG + Intronic
1138077386 16:54056285-54056307 AACTGTAAACTCTGTGAGGGCGG + Intronic
1138461553 16:57151307-57151329 GATGGTAACAGCACTGAGGGTGG + Intergenic
1142885800 17:2911552-2911574 GACGGCAGGCTCTCTGAGGGTGG - Intronic
1143511954 17:7401330-7401352 GATGGGAAACTCCTTGAGGGAGG + Intronic
1143874368 17:9980715-9980737 GACTGTAAGCTCCCTGAGGGTGG - Intronic
1144226430 17:13152865-13152887 GATGATATACTGTGTGAGGGAGG + Intergenic
1145088481 17:19965098-19965120 GATGGTAAAGTCAATGTGGGTGG - Intronic
1148992532 17:51679055-51679077 AATGGTAAACTCTTTGAGGGTGG - Intronic
1149980943 17:61310726-61310748 GATGGTGAGCTCTTGGAGGGCGG - Intronic
1150811830 17:68362852-68362874 GATGTTAAACTCCAAGAGGGTGG + Intronic
1157235669 18:45963115-45963137 GATTTTGAACTCACTGAGGGAGG - Intronic
1157788944 18:50512965-50512987 GGTGGTAAACTTTCTGAGTCTGG + Intergenic
1158975800 18:62710464-62710486 GATTGTAAATTTTATGAGGGAGG + Intergenic
1161596629 19:5154102-5154124 GAGGGTCACCTCCCTGAGGGAGG - Intergenic
1163913295 19:20215578-20215600 CATGGTGAAGTCACTGAGGGTGG + Intergenic
926178329 2:10617026-10617048 GAAGGTAAGCTCCTTGAGGGTGG - Intronic
928845304 2:35664405-35664427 AATGGTAAACTCTCTTTGTGTGG + Intergenic
930641983 2:53862698-53862720 TATGGGCCACTCTCTGAGGGTGG - Intergenic
933839336 2:86273868-86273890 CATTGTAAGCTCCCTGAGGGTGG + Intronic
935544725 2:104388697-104388719 GTAGGTAAGCTATCTGAGGGAGG - Intergenic
936860299 2:117009043-117009065 AATTGTAAGCTCTCTGTGGGAGG + Intergenic
941569974 2:167158542-167158564 CATGGTAAACTCTGTGAAGATGG - Intronic
942018919 2:171847539-171847561 GATGGGATTCTCTCTGGGGGTGG - Intronic
942699834 2:178693379-178693401 GATTGCAAACTCTCTGAAGCAGG + Intronic
945452547 2:210010093-210010115 GACTATAAACTCTCTGAGGGCGG + Intronic
945950589 2:216035288-216035310 GATGCAAAACCCCCTGAGGGAGG - Intronic
947814346 2:233025972-233025994 GATTCTAATCTCTTTGAGGGTGG - Intergenic
1168808206 20:685351-685373 GATGGTGAACTCTTCAAGGGCGG + Intergenic
1170435221 20:16319675-16319697 ATTGTTAAAATCTCTGAGGGGGG + Intronic
1170936161 20:20811562-20811584 GATGGTACACTTTCTTTGGGAGG - Intergenic
1174949092 20:55024089-55024111 AATGGTAACATCTCTCAGGGTGG - Intergenic
1175091877 20:56511620-56511642 GCTGGGTAACTCTCTGTGGGGGG + Intronic
1175660465 20:60808232-60808254 GATGGTGAAAGCTCTTAGGGTGG - Intergenic
1175793681 20:61758034-61758056 GAAGGTAAGCTCGGTGAGGGCGG - Intronic
1178487653 21:33029065-33029087 GATGATACACTCTCTGCGAGGGG - Exonic
1179428013 21:41296917-41296939 GATGTTAGAATCTCTGGGGGTGG + Intergenic
1181846891 22:25717468-25717490 GATTGTAAGCTCTCTGAAGCAGG + Intronic
1182249127 22:28985583-28985605 GATGGTCAGCTCTCAGAGGAAGG + Intronic
1184890345 22:47375339-47375361 GCGGGCAAGCTCTCTGAGGGTGG - Intergenic
1185289885 22:50017951-50017973 GGTGGCAAAGTCTCAGAGGGAGG - Intronic
1185413942 22:50699697-50699719 GCTGGGAAACTCTCAGAGGTGGG - Intergenic
949108160 3:225288-225310 GACTGTACACTCTCTGAGGGTGG - Intronic
949550109 3:5105412-5105434 GACTGTAAACTCTCAGAAGGAGG + Intergenic
951510407 3:23494834-23494856 GATGGGATACTATCTGAGGCAGG - Intronic
952696986 3:36277437-36277459 GATGGGAAACTTTCTCAAGGTGG - Intergenic
952982358 3:38747383-38747405 GGTTGTAAAATCTATGAGGGCGG - Intronic
953573817 3:44096726-44096748 GAATGTAAACTCTGTGAGGGTGG - Intergenic
954986009 3:54792722-54792744 GGTGGTAAAATCCCTGAGTGTGG - Intronic
955487630 3:59450549-59450571 GACGGTAAACTCCATGAGGCAGG + Intergenic
956647903 3:71474972-71474994 GATGGGAAACTCCATGAGGAAGG - Intronic
957129609 3:76206115-76206137 GATGGTCAGCTCTCTAAGAGTGG - Intronic
960160491 3:114345297-114345319 GAATGTAAACTCTGTGAGAGCGG - Intronic
960604200 3:119488258-119488280 GATGGTAAACTCCTTGATGAGGG - Intronic
971827689 4:31647109-31647131 GAGGGTAAATTCTCTCAGAGAGG - Intergenic
973931681 4:55799496-55799518 GATGGGAAACTGTCAGAGGAAGG + Intergenic
974137644 4:57838580-57838602 GGTGGTAAACTCTTTTAGGAAGG + Intergenic
974557717 4:63473022-63473044 GGTGGTAAACTCTCTAATAGAGG + Intergenic
974943712 4:68500747-68500769 GACTGTAAACTCCATGAGGGTGG + Intergenic
975270677 4:72428990-72429012 CATGGAAAAGTCTCTGAGGTTGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978460502 4:108946611-108946633 GATGGTAAACCCTGTGAGCTTGG - Intronic
978875990 4:113640484-113640506 GATAGTAAGCTCTCTGAGGATGG - Intronic
979565233 4:122147149-122147171 GACTGTAAATTCTCTGAGGAAGG - Intergenic
980848160 4:138349018-138349040 GATGATGAACTCTGTGAGGGAGG + Intergenic
980947583 4:139338082-139338104 AATGTTAAACTCTTTGAGGGTGG + Intronic
984615378 4:181891048-181891070 GAAGGCATACTCTCTGTGGGTGG + Intergenic
986428364 5:7656744-7656766 GATTGTAATCCCTCTGAAGGGGG + Intronic
986833084 5:11603826-11603848 GATGGTAAGCTGTGTGAGGGTGG - Intronic
988491010 5:31705747-31705769 GAATGTAAACTCTATGAGAGGGG + Intronic
991469468 5:66952720-66952742 GATTGTAAAGTCTCTGACGGTGG - Intronic
996433988 5:123414156-123414178 GAAGGTAAATCCTCTTAGGGGGG - Intronic
999963158 5:156778703-156778725 GATTGTAAACTCCATGATGGTGG - Intergenic
1000042706 5:157496962-157496984 GATGGTACCCCCTGTGAGGGCGG - Exonic
1003684278 6:8285646-8285668 GATGGTGAAATGTGTGAGGGCGG + Intergenic
1003769478 6:9282384-9282406 GATGGTAGAGTCTCTGAAGGGGG + Intergenic
1005650562 6:27881289-27881311 GATGGTGATTTCTCTGAGGCAGG - Intergenic
1008239350 6:49089971-49089993 GACAGTAAATTCTCTGAGGGAGG - Intergenic
1008273819 6:49520458-49520480 GAGGCTTAACTCCCTGAGGGAGG + Intronic
1009837360 6:69019681-69019703 GATGTTAAACTCTCTGATTAAGG - Intronic
1013673897 6:112435650-112435672 AGTGGTAAACTCCTTGAGGGTGG + Intergenic
1013778008 6:113700572-113700594 AATGGTATACTCGCTGAGGATGG - Intergenic
1014486276 6:122003078-122003100 GATTGTAATCTCTCTGAGGAAGG + Intergenic
1015621691 6:135138758-135138780 TAAGGTAAAATCTCTGAGAGGGG - Intergenic
1015622128 6:135142187-135142209 GATGGTAAGCTCTGGGAGGACGG + Intergenic
1016264855 6:142220884-142220906 GAATGTAAACTCTATGAGGGAGG - Exonic
1017821947 6:158055436-158055458 AATAGTAAAATCTCTGAGAGTGG - Intronic
1018071791 6:160171138-160171160 GAAAGTAACTTCTCTGAGGGCGG - Intronic
1018373290 6:163187633-163187655 GATGGGAAACCCACTGAGTGAGG - Intronic
1018480471 6:164184450-164184472 GATAGTTAGCTCTCTGAGGACGG + Intergenic
1020407143 7:7849655-7849677 AATGGTAAACTCCATGAGGCAGG - Intronic
1020704473 7:11526763-11526785 GATTGTAAATTTTCTGAGTGAGG + Intronic
1022285421 7:28952550-28952572 GATGCTATACTTTCTGAGGATGG + Intergenic
1022380415 7:29854032-29854054 GCTGGTAAACTCCCTAAGGAAGG + Intronic
1025062370 7:55821399-55821421 CAAGGTAAAATCTCTGAGGCAGG - Intronic
1030268346 7:107643933-107643955 TATAGTAAAATCTCTGAGGAAGG + Intergenic
1033411759 7:141124524-141124546 GACTGTAAGCTCTCTGAGGGCGG + Intronic
1033956879 7:146860383-146860405 GAATGCAAAGTCTCTGAGGGTGG + Intronic
1035417745 7:158704400-158704422 GAGGGGACACTCTCTGAGGACGG + Intronic
1035918538 8:3652065-3652087 GGTGGTAAGCGCTCTGATGGGGG - Intronic
1035918548 8:3652134-3652156 GGTGGTAAGCGCTCTGATGGTGG - Intronic
1035918550 8:3652152-3652174 GGTGGTAAGCGCTCTGATGGTGG - Intronic
1038212934 8:25536639-25536661 GGTGGTAGTCTCTCTGAGGAGGG + Intergenic
1042865053 8:73349600-73349622 GACAGTAAGCTCTTTGAGGGTGG - Intergenic
1044489352 8:92793656-92793678 GACTGTCAACTCTCTGAGGCAGG - Intergenic
1048007440 8:130430967-130430989 AGTGGGAAACTATCTGAGGGAGG - Intronic
1048560727 8:135534509-135534531 GATGGTGATTTCTCTGAGCGCGG - Intronic
1049919571 9:350894-350916 GTTTGTAAACTTCCTGAGGGTGG + Intronic
1057403279 9:94743643-94743665 GATGGGAAAATCAATGAGGGAGG + Intronic
1057994072 9:99803890-99803912 GTATGTAAACTCTTTGAGGGAGG - Intergenic
1058437149 9:104973457-104973479 GATGGTCAGCTCTTTGAGGCGGG + Intergenic
1058778614 9:108310512-108310534 GACTGTAAACACTCTGAGAGTGG + Intergenic
1059009721 9:110443577-110443599 GATGGGAAATTATCTGACGGTGG - Exonic
1059382296 9:113935723-113935745 GACTGCAAACTCTTTGAGGGTGG + Intronic
1059635145 9:116163139-116163161 GAATATAAACTCCCTGAGGGCGG - Intronic
1061205223 9:129159148-129159170 GATGGTAAGCCCAGTGAGGGAGG + Intergenic
1061605264 9:131705324-131705346 GATTGTAAACCACCTGAGGGCGG - Intronic
1186687933 X:11945052-11945074 GATGTCAGACTCTCTGAGGGTGG + Intergenic
1190212413 X:48459115-48459137 GATGGAGCACTCTCTGAAGGAGG - Intronic
1192425760 X:71074715-71074737 CATTGTAAACTCCCTAAGGGAGG + Intergenic
1198953321 X:142098076-142098098 AATGGTAAAAGCTCTGAGGCAGG + Intergenic