ID: 1081719638

View in Genome Browser
Species Human (GRCh38)
Location 11:45278701-45278723
Sequence CTGTACCCAAAGAAGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081719635_1081719638 16 Left 1081719635 11:45278662-45278684 CCATGAAGAGAAGAGCCATGTAT 0: 1
1: 0
2: 1
3: 24
4: 292
Right 1081719638 11:45278701-45278723 CTGTACCCAAAGAAGGAACTAGG 0: 1
1: 0
2: 4
3: 10
4: 181
1081719636_1081719638 1 Left 1081719636 11:45278677-45278699 CCATGTATCTGAATTATCTACAA 0: 1
1: 0
2: 1
3: 24
4: 362
Right 1081719638 11:45278701-45278723 CTGTACCCAAAGAAGGAACTAGG 0: 1
1: 0
2: 4
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081719638 Original CRISPR CTGTACCCAAAGAAGGAACT AGG Intronic
903308496 1:22432354-22432376 GTGTACCCAAGGAAGGGACAAGG - Intergenic
904260426 1:29284639-29284661 CTGTGCCCAAGGAACAAACTGGG - Intronic
907595868 1:55719267-55719289 CTGAAACCAGAGAAGGAACCTGG - Intergenic
908564571 1:65341249-65341271 TGGTTTCCAAAGAAGGAACTAGG - Intronic
914781761 1:150792009-150792031 CTGTAACCAAATAAGGCCCTGGG + Intergenic
915142242 1:153774986-153775008 CTCTCCCAAAAGAATGAACTTGG - Intronic
917154933 1:171986206-171986228 TGGTACCCAAAAAAGGAAGTGGG - Intronic
917661101 1:177177951-177177973 CTTTAACCAAAGCAGGAATTTGG - Intronic
919467150 1:197936059-197936081 CTGTACTCAATAAAGTAACTAGG - Intergenic
919546506 1:198927371-198927393 CTGTATTCAAATAAGGATCTTGG + Intergenic
1063484036 10:6402531-6402553 GTGTACCCAAAGAAGCAAAGGGG + Intergenic
1064582594 10:16809386-16809408 CTCTACCCAAAGACAGAACCTGG + Intronic
1065993696 10:31036619-31036641 CTGTACTCAAATCAAGAACTGGG - Intergenic
1066228039 10:33403721-33403743 CTGTACCCAGAAAATGGACTGGG - Intergenic
1066581927 10:36890678-36890700 CTGAACACACAGGAGGAACTCGG - Intergenic
1067021206 10:42799898-42799920 ATGTAACCAAAGAAAGAAATGGG - Intronic
1067657598 10:48208503-48208525 CTGGCTCCAAAGCAGGAACTTGG - Intronic
1068253579 10:54476977-54476999 CTGGAGGCAAAGAAGGAAGTTGG - Intronic
1068605547 10:59001112-59001134 CTTTACCCAAAAATGTAACTTGG + Intergenic
1069794875 10:71045657-71045679 ATGTACCCAGAAGAGGAACTGGG + Intergenic
1070351489 10:75597065-75597087 CTCTAGCCAAATAAGGAACACGG - Intronic
1071667017 10:87568340-87568362 CTGTTCCAAAAGGAGGAAATAGG - Intergenic
1075300091 10:121314555-121314577 CTGTACCCAGAGGAGGCACTGGG - Intergenic
1076789503 10:132769295-132769317 CTGTCCCTAAAGAAGGCGCTAGG - Intronic
1078224646 11:9380920-9380942 CTGTATCCAAAAAAGGAGCTTGG - Intergenic
1079028073 11:16964576-16964598 CTGCAACCAGAGAAGCAACTAGG + Intronic
1081719638 11:45278701-45278723 CTGTACCCAAAGAAGGAACTAGG + Intronic
1082181028 11:49119845-49119867 CTTTATCCAAAGAAGGAAAGTGG - Intergenic
1085585903 11:77705694-77705716 CTGGACCCAAAGAAGGGAAAAGG - Intronic
1086280734 11:85184575-85184597 CTGTACCAAATGAGGGAAATGGG - Intronic
1086684461 11:89715027-89715049 CTTTATCCAAAGAAGGAAAGTGG + Intronic
1088175057 11:107044077-107044099 CTGTGCACAAAGCAGGAAGTGGG - Intergenic
1088294783 11:108280844-108280866 TTGTACCAAAAGACAGAACTAGG + Intronic
1089836490 11:121375068-121375090 CTGTACCCAGTGAAGGATTTGGG - Intergenic
1090101475 11:123801780-123801802 CTGTATTCAAAGAAGAAATTAGG - Intergenic
1090366000 11:126206248-126206270 CTGTACCCGAAGAAGTCACAGGG + Intronic
1094527826 12:31244312-31244334 CTGAAGGCAAAGAAAGAACTAGG + Intergenic
1094702107 12:32880010-32880032 CTGTTCCCAAGGCAGGAATTCGG + Intronic
1095389284 12:41686731-41686753 TTGAACCCAAGGAAGGCACTAGG - Intergenic
1097013004 12:55966593-55966615 TTGGACCCAAAGCAGGTACTTGG + Intronic
1098812218 12:75109312-75109334 CAGTAACCAAAGAAGAAACACGG + Intronic
1099785616 12:87258878-87258900 CTGCATCCAAAGAATAAACTTGG - Intergenic
1105580113 13:21687814-21687836 CTGTCCCCCAAGAATGGACTGGG - Intronic
1106528342 13:30563643-30563665 ATGTACCAAAAGAAAGAAATGGG - Intronic
1109112670 13:58342955-58342977 CTGTAACCAAAAAGGTAACTTGG + Intergenic
1111068370 13:83128590-83128612 CTGCACCCAAAAAAGGCACAGGG + Intergenic
1112446888 13:99472270-99472292 CAGCACCCAAAGAAGGAACTGGG - Intergenic
1113110222 13:106814658-106814680 CTGTGACCACAGAAGGATCTAGG + Intergenic
1118574866 14:67232093-67232115 CTGTACCCAAAGGAAGCAATAGG - Intergenic
1120025973 14:79584655-79584677 CTGTACCCATAGCAGTAGCTGGG - Intronic
1121224787 14:92313416-92313438 CTGGAACCAAGGAAGAAACTGGG - Intergenic
1121595766 14:95160984-95161006 CTGAGCCCAAAGAAGGAAGGTGG + Intergenic
1123119502 14:105910186-105910208 CTCTACCCAGAGAAGGAGCCAGG - Intergenic
1124452314 15:29806526-29806548 CTTTGCTCACAGAAGGAACTTGG - Intronic
1127328751 15:57918985-57919007 CTGTACCCAATGGAAGAACAAGG + Intergenic
1127937394 15:63655025-63655047 CTGTAACCAGTCAAGGAACTGGG + Intronic
1129332208 15:74833469-74833491 CTGGTCCCCAGGAAGGAACTGGG + Intergenic
1129526482 15:76219201-76219223 CTGTTCCCATTGAATGAACTTGG - Intronic
1129801279 15:78416632-78416654 CCAAACCCAAAGAATGAACTCGG + Intergenic
1131629326 15:94159243-94159265 CTGTACCCAAAGAAGGCAGTAGG - Intergenic
1132773478 16:1578335-1578357 CTGGGTCCCAAGAAGGAACTTGG + Intronic
1133412234 16:5578426-5578448 CTGAATCCCAAGAAGGACCTTGG + Intergenic
1134046981 16:11108295-11108317 CCTAAGCCAAAGAAGGAACTAGG + Intronic
1142025187 16:87808981-87809003 CTGTACACAAAGAAGAAAGAAGG + Intergenic
1142225255 16:88874029-88874051 GTGTACCCAAAGAAGGATCCAGG + Intergenic
1142472000 17:169851-169873 ATTTACACAGAGAAGGAACTGGG + Intronic
1142621582 17:1168868-1168890 CTACACCCAAAGATGGCACTTGG + Intronic
1142756296 17:2018336-2018358 CTGTCCCCAAGGAAGAAACCAGG + Intronic
1143396100 17:6598519-6598541 CTGAAACCTAAGAAGGAAGTTGG + Intronic
1143978632 17:10848610-10848632 CAGTGACCACAGAAGGAACTTGG + Intergenic
1147173692 17:38637486-38637508 CTAAAAACAAAGAAGGAACTGGG + Intergenic
1148070470 17:44905816-44905838 CTGTGCCCAGAGATGGGACTGGG - Intronic
1153658041 18:7302747-7302769 CTGTTCACAGAGATGGAACTCGG + Intergenic
1153852593 18:9110113-9110135 CTGTACTCAAAGAAGGGGGTGGG + Intronic
1155642561 18:28037004-28037026 CTTTCTCTAAAGAAGGAACTTGG + Intronic
1156991848 18:43418702-43418724 CTGTGCCCAGAGTAGCAACTTGG - Intergenic
1157245658 18:46052050-46052072 CTATACCCAAAACTGGAACTAGG + Intronic
1158994520 18:62904260-62904282 CTGAACCCATAGAAGTAATTAGG + Intronic
1160902659 19:1436459-1436481 CTGTCCCCAAAATATGAACTGGG - Intergenic
1162759248 19:12878835-12878857 CTGGACCAAAAGAAGGCATTAGG + Intronic
1162978721 19:14224407-14224429 ATTTACCCAAATAAGAAACTTGG - Intergenic
1163453475 19:17392673-17392695 CTGGACCAAGAGAAGGGACTGGG - Intergenic
1163826065 19:19525685-19525707 CTGCACCCCAGGAAGGACCTAGG - Intronic
1166284214 19:41813859-41813881 CTGTACCCAAAGTATGACCTTGG + Intergenic
1166595050 19:44039611-44039633 CTGGCCTCAGAGAAGGAACTAGG - Intergenic
1168675668 19:58276300-58276322 CTGTAGGCAGAGAAGGTACTAGG - Intronic
925944833 2:8851105-8851127 CTGTACCAAAAGATACAACTGGG + Intergenic
926173001 2:10565176-10565198 CTGTACCCTCAGGAGGAACTTGG + Intergenic
927506867 2:23620519-23620541 CTGTTCCTAAAGCAGGAATTTGG - Intronic
928906477 2:36373517-36373539 CTGTACCCAAAGATGGCACTTGG + Intronic
931707352 2:64958137-64958159 CTTTACCCCAAGAAGGCTCTTGG + Intergenic
933102877 2:78282444-78282466 CTGTACCCAGAAAAGCTACTGGG + Intergenic
933521647 2:83381535-83381557 CTGTTCCCAAAGGAAGAACTAGG - Intergenic
933542793 2:83669565-83669587 CTGTGTCAAAAGCAGGAACTAGG + Intergenic
935828453 2:106974570-106974592 CAGCACCCAAAGGAGGACCTAGG + Intergenic
935828459 2:106974603-106974625 CAGCACCCAAAGGAGGACCTAGG + Intergenic
935828465 2:106974636-106974658 CAGCACCCAAAGGAGGACCTAGG + Intergenic
935828471 2:106974669-106974691 CAGCACCCAAAGGAGGACCTAGG + Intergenic
936348924 2:111697844-111697866 CAGTACCCAAACCAGGAACCTGG - Intergenic
937253355 2:120538117-120538139 CTGTGCCCAGAGGAGGAACAGGG + Intergenic
938449217 2:131401357-131401379 ATGTGCCCAAAGAAGGTCCTGGG + Intergenic
938775024 2:134534059-134534081 CTGGACCTAAAGAAGGAGATGGG - Intronic
940120242 2:150256387-150256409 CTGAACCCAAAGAAAGGTCTGGG - Intergenic
943452580 2:188063320-188063342 CTGTAACCAATGAAGAAAGTGGG - Intergenic
943952969 2:194154780-194154802 CTGAACCCAAAGAATGGACTTGG + Intergenic
944057201 2:195535130-195535152 ATATACTCAGAGAAGGAACTTGG + Intergenic
946122375 2:217527618-217527640 CTGTCTCCTGAGAAGGAACTGGG + Intronic
946398237 2:219454122-219454144 GTGGACCCCAAGAGGGAACTGGG - Intronic
1169280243 20:4260978-4261000 CTGGATCCAGGGAAGGAACTTGG + Intergenic
1169354900 20:4898057-4898079 CTGTACCCAAAGAATGAAAGAGG + Intronic
1170173702 20:13443364-13443386 CTATATCCACAGAGGGAACTGGG + Intronic
1170702360 20:18714849-18714871 CAGTACCCCAAGGAGAAACTGGG + Intronic
1175108124 20:56628761-56628783 CTGTGCCCACGGAGGGAACTGGG + Intergenic
1175883334 20:62273089-62273111 CAGCACAGAAAGAAGGAACTGGG - Intronic
1177882483 21:26710532-26710554 CTGTGCCCAAGGAAGGATATCGG - Intergenic
949179393 3:1110078-1110100 CTGTTCCTAAAGAAGGACATTGG - Intronic
950019981 3:9780282-9780304 CTGTGCCCAAAGAAGGAAGTGGG + Exonic
950252285 3:11475797-11475819 CTGTACCCTAAGTAGGCAGTTGG + Intronic
951201625 3:19881601-19881623 CTGGCCCCAAAGGAGGAACTTGG - Intronic
951649310 3:24932020-24932042 AGGTATCCAAAGATGGAACTTGG - Intergenic
954283806 3:49603378-49603400 CAGGAACCAAAGAAGGAATTGGG - Intronic
956075841 3:65504531-65504553 CTGTACACAAAGAAGACATTGGG + Intronic
956201230 3:66708300-66708322 CTGGACCCAAAAAAAGAGCTGGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
962408675 3:135122293-135122315 CTGGACTCAAAGAAAAAACTGGG - Intronic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
963927440 3:150966001-150966023 CTTTACCCAGAAGAGGAACTTGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969880111 4:10166286-10166308 CTATATCTGAAGAAGGAACTAGG - Intergenic
970027398 4:11638050-11638072 TTTGACACAAAGAAGGAACTTGG + Intergenic
971887559 4:32473141-32473163 CTGAACCCAAAGCAGCATCTAGG + Intergenic
984254166 4:177370478-177370500 CTGTACTCAAAGGAGGGCCTGGG + Intergenic
985411618 4:189691689-189691711 CTGCACACAAAGCAGCAACTTGG + Intergenic
985790492 5:1924362-1924384 CAGTCCCCCAAGAAGGCACTGGG - Intergenic
988154365 5:27431008-27431030 ATGGACACATAGAAGGAACTGGG + Intergenic
988486320 5:31670970-31670992 CTGCACCCAATGAAGGAATAAGG - Intronic
989076426 5:37568162-37568184 CTGTACCACAAGAAGGAGCCAGG - Intronic
990662065 5:58027192-58027214 CTGAACTCCAAGACGGAACTGGG - Intergenic
991614165 5:68478723-68478745 CTCTACCCACAGAATGATCTAGG + Intergenic
991731772 5:69596668-69596690 CTGGATCCAAAGCAGGCACTAGG - Intergenic
991808204 5:70451806-70451828 CTGGATCCAAAGCAGGCACTAGG - Intergenic
991863180 5:71031199-71031221 CTGGATCCAAAGCAGGCACTAGG + Intergenic
993142185 5:84048813-84048835 CTGCACTCAAAGAATTAACTTGG - Intronic
994017516 5:94985219-94985241 CTGTCTCCAAAGAAAGTACTTGG - Intronic
995063038 5:107832019-107832041 CTGTATCCCAGGAAGGAAATAGG + Intergenic
998529528 5:142871893-142871915 CTACACCAAAAGAAGGCACTTGG - Intronic
1000516241 5:162238952-162238974 CTGTACCCTAAGAGGAAACAGGG + Intergenic
1001335510 5:170793255-170793277 CTTTTCCCAAATAAAGAACTGGG + Intronic
1002300999 5:178257251-178257273 CTGTCCCCAAGCCAGGAACTGGG - Intronic
1005030240 6:21501481-21501503 CTGTATGCAAAGAAGGAAGATGG - Intergenic
1006228922 6:32565266-32565288 CTGTAACCAAGGAAGTCACTGGG - Intronic
1007048699 6:38803777-38803799 CTCTACACAGAGAAGGATCTAGG - Intronic
1008795167 6:55294169-55294191 CTGTATGCAAAGATGGGACTCGG - Intergenic
1009642893 6:66361198-66361220 CGGTATCCAAGTAAGGAACTTGG + Intergenic
1017781927 6:157721994-157722016 CTGGACCCAAAGGAGGACTTAGG - Intronic
1019966791 7:4506055-4506077 CATTTTCCAAAGAAGGAACTGGG + Intergenic
1021517051 7:21500904-21500926 CTGAACCCAAAGACTGCACTTGG + Intronic
1021523093 7:21555913-21555935 CCGAACCCAAAGAATGGACTTGG + Intronic
1023917558 7:44601476-44601498 CTGTACCTAGAGAAGGTATTGGG - Intergenic
1028017865 7:85737831-85737853 TTTTACCCAAATAAGGAAGTGGG + Intergenic
1029325888 7:99808403-99808425 CCAAACCCAAAGAATGAACTTGG + Intergenic
1031912356 7:127531668-127531690 CTGAACCCAAAGATCCAACTGGG + Intergenic
1033908572 7:146237149-146237171 CTGTACCAGAAGCAGGACCTTGG + Intronic
1033939002 7:146627740-146627762 TTGTACCTAAATAAGGAAGTTGG - Intronic
1034528468 7:151680967-151680989 CTGTACCCAAAGAACTAGCAAGG - Intronic
1036462859 8:8969526-8969548 CTGTTCTAAAAGATGGAACTTGG + Intergenic
1037770269 8:21794847-21794869 CTGATCCCAAAGAATGAACAGGG + Intronic
1039550022 8:38436657-38436679 CTATCCCCTAAGAAGGAATTAGG + Intronic
1041037577 8:53810356-53810378 CTTTAGCCAAGAAAGGAACTTGG + Intronic
1041901225 8:62985235-62985257 CTCTTCCCAAAACAGGAACTCGG + Intronic
1045974521 8:108116270-108116292 CTGCAACCACAGAAAGAACTAGG + Intergenic
1046745905 8:117875694-117875716 CTCTCCCCAAAGATGGTACTTGG - Intronic
1048252174 8:132875881-132875903 CTGTGCCCAGAGAAGTCACTGGG - Intronic
1051101589 9:13528705-13528727 CTCTACCCCAAGCAGGAACCAGG - Intergenic
1052256178 9:26459475-26459497 CTGTTCCCAAAGAAACAGCTTGG - Intergenic
1057515366 9:95715913-95715935 ATTTTCACAAAGAAGGAACTCGG + Intergenic
1058133021 9:101274849-101274871 CTGAACCCACAGAAGGAACATGG - Intronic
1061126235 9:128677887-128677909 CTGTCCCCAGAGAAAGGACTGGG - Intergenic
1061954362 9:133953825-133953847 CTGTCTCCAAAGAAGGCACCTGG + Intronic
1062547195 9:137069159-137069181 CTGTTCCCAAGGCAGGCACTGGG + Intronic
1203624679 Un_KI270750v1:2766-2788 CTTTAACCATAGAAGGAATTTGG - Intergenic
1203670978 Un_KI270755v1:11293-11315 CTGCACACAAAGCAGCAACTTGG - Intergenic
1185885360 X:3777560-3777582 CTGTTCTCAAAGAAAGATCTGGG + Intergenic
1189498442 X:41530640-41530662 CTGTACCCAGAGAGGGAAGGTGG + Intronic
1189767594 X:44387995-44388017 AAGTAGCCAAAGAAGTAACTGGG - Intergenic
1190876243 X:54462275-54462297 CTGGACCCCTAGAAAGAACTAGG - Intronic
1194086882 X:89538918-89538940 CTGCAGCCAAAGAAGGGAGTAGG + Intergenic
1194709281 X:97215378-97215400 ATGTACACTAAGAAGGAAATAGG + Intronic
1195002865 X:100658912-100658934 CTGTACCCAAAGAATGCCCATGG - Intronic
1195094512 X:101491630-101491652 CTGTGCCTAAAGCAGGGACTGGG + Exonic
1195666588 X:107436934-107436956 CTGACCCCAAAGAAGGATTTTGG - Intergenic
1197190863 X:123646729-123646751 TGGTAAGCAAAGAAGGAACTGGG + Intronic
1200907030 Y:8494186-8494208 CTATACCTAAAGAAGAACCTAGG + Intergenic
1202259818 Y:22958729-22958751 CTATACCTAAAGAAGCACCTAGG + Intergenic
1202412804 Y:24592473-24592495 CTATACCTAAAGAAGCACCTAGG + Intergenic
1202457977 Y:25077597-25077619 CTATACCTAAAGAAGCACCTAGG - Intergenic