ID: 1081723464

View in Genome Browser
Species Human (GRCh38)
Location 11:45307004-45307026
Sequence GGCCCCACCTCAAGTAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081723464_1081723473 17 Left 1081723464 11:45307004-45307026 CCCATGCTACTTGAGGTGGGGCC No data
Right 1081723473 11:45307044-45307066 CTCTCCATTTCCTTCCTGGTGGG No data
1081723464_1081723472 16 Left 1081723464 11:45307004-45307026 CCCATGCTACTTGAGGTGGGGCC No data
Right 1081723472 11:45307043-45307065 CCTCTCCATTTCCTTCCTGGTGG No data
1081723464_1081723469 13 Left 1081723464 11:45307004-45307026 CCCATGCTACTTGAGGTGGGGCC No data
Right 1081723469 11:45307040-45307062 CACCCTCTCCATTTCCTTCCTGG No data
1081723464_1081723476 29 Left 1081723464 11:45307004-45307026 CCCATGCTACTTGAGGTGGGGCC No data
Right 1081723476 11:45307056-45307078 TTCCTGGTGGGCCCAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081723464 Original CRISPR GGCCCCACCTCAAGTAGCAT GGG (reversed) Intergenic
No off target data available for this crispr