ID: 1081724934

View in Genome Browser
Species Human (GRCh38)
Location 11:45321476-45321498
Sequence GAGTGTGCTCCAAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081724934_1081724944 21 Left 1081724934 11:45321476-45321498 CCCTCCTCCCTTGGAGCACACTC No data
Right 1081724944 11:45321520-45321542 GGCCAGACCCTCTTTGTCTCTGG No data
1081724934_1081724939 0 Left 1081724934 11:45321476-45321498 CCCTCCTCCCTTGGAGCACACTC No data
Right 1081724939 11:45321499-45321521 AGATCCTAGAGTCTATTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081724934 Original CRISPR GAGTGTGCTCCAAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr