ID: 1081726547

View in Genome Browser
Species Human (GRCh38)
Location 11:45333826-45333848
Sequence TTTCCCGGAAGCCCTGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081726543_1081726547 -8 Left 1081726543 11:45333811-45333833 CCCAGAAAGAAAATATTTCCCGG No data
Right 1081726547 11:45333826-45333848 TTTCCCGGAAGCCCTGCAGGAGG No data
1081726542_1081726547 -2 Left 1081726542 11:45333805-45333827 CCTGTGCCCAGAAAGAAAATATT No data
Right 1081726547 11:45333826-45333848 TTTCCCGGAAGCCCTGCAGGAGG No data
1081726545_1081726547 -9 Left 1081726545 11:45333812-45333834 CCAGAAAGAAAATATTTCCCGGA No data
Right 1081726547 11:45333826-45333848 TTTCCCGGAAGCCCTGCAGGAGG No data
1081726541_1081726547 6 Left 1081726541 11:45333797-45333819 CCGTGATTCCTGTGCCCAGAAAG No data
Right 1081726547 11:45333826-45333848 TTTCCCGGAAGCCCTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081726547 Original CRISPR TTTCCCGGAAGCCCTGCAGG AGG Intergenic
No off target data available for this crispr