ID: 1081728175

View in Genome Browser
Species Human (GRCh38)
Location 11:45347634-45347656
Sequence GCCTCACCAAAGCCCCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081728175_1081728177 -5 Left 1081728175 11:45347634-45347656 CCTGCAAGGGGCTTTGGTGAGGC No data
Right 1081728177 11:45347652-45347674 GAGGCAGGCGAGAGTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081728175 Original CRISPR GCCTCACCAAAGCCCCTTGC AGG (reversed) Intergenic
No off target data available for this crispr