ID: 1081728177

View in Genome Browser
Species Human (GRCh38)
Location 11:45347652-45347674
Sequence GAGGCAGGCGAGAGTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081728175_1081728177 -5 Left 1081728175 11:45347634-45347656 CCTGCAAGGGGCTTTGGTGAGGC No data
Right 1081728177 11:45347652-45347674 GAGGCAGGCGAGAGTCTGCTAGG No data
1081728173_1081728177 -4 Left 1081728173 11:45347633-45347655 CCCTGCAAGGGGCTTTGGTGAGG No data
Right 1081728177 11:45347652-45347674 GAGGCAGGCGAGAGTCTGCTAGG No data
1081728171_1081728177 5 Left 1081728171 11:45347624-45347646 CCAGAGGGGCCCTGCAAGGGGCT No data
Right 1081728177 11:45347652-45347674 GAGGCAGGCGAGAGTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081728177 Original CRISPR GAGGCAGGCGAGAGTCTGCT AGG Intergenic
No off target data available for this crispr