ID: 1081731737

View in Genome Browser
Species Human (GRCh38)
Location 11:45376510-45376532
Sequence CCAAGCTACCACCTTAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081731737_1081731740 -3 Left 1081731737 11:45376510-45376532 CCCACACTAAGGTGGTAGCTTGG No data
Right 1081731740 11:45376530-45376552 TGGAGTTAGATCACCAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081731737 Original CRISPR CCAAGCTACCACCTTAGTGT GGG (reversed) Intergenic
No off target data available for this crispr