ID: 1081734046

View in Genome Browser
Species Human (GRCh38)
Location 11:45391265-45391287
Sequence CTCCGAGGCCATCACTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081734046_1081734066 20 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734066 11:45391308-45391330 AGGGCGGTTGGAGGAGGAGAGGG No data
1081734046_1081734059 0 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734059 11:45391288-45391310 CTGGGGAGTGGGGGGATTGGAGG No data
1081734046_1081734061 4 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734061 11:45391292-45391314 GGAGTGGGGGGATTGGAGGGCGG No data
1081734046_1081734067 21 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734067 11:45391309-45391331 GGGCGGTTGGAGGAGGAGAGGGG No data
1081734046_1081734062 8 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734062 11:45391296-45391318 TGGGGGGATTGGAGGGCGGTTGG No data
1081734046_1081734055 -9 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734055 11:45391279-45391301 GCCTCGGAGCTGGGGAGTGGGGG No data
1081734046_1081734063 11 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734063 11:45391299-45391321 GGGGATTGGAGGGCGGTTGGAGG No data
1081734046_1081734064 14 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734064 11:45391302-45391324 GATTGGAGGGCGGTTGGAGGAGG No data
1081734046_1081734058 -3 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734058 11:45391285-45391307 GAGCTGGGGAGTGGGGGGATTGG No data
1081734046_1081734060 1 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734060 11:45391289-45391311 TGGGGAGTGGGGGGATTGGAGGG No data
1081734046_1081734065 19 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734065 11:45391307-45391329 GAGGGCGGTTGGAGGAGGAGAGG No data
1081734046_1081734054 -10 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734054 11:45391278-45391300 GGCCTCGGAGCTGGGGAGTGGGG No data
1081734046_1081734057 -8 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734057 11:45391280-45391302 CCTCGGAGCTGGGGAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081734046 Original CRISPR CTCCGAGGCCATCACTGGGC AGG (reversed) Intergenic
No off target data available for this crispr