ID: 1081734057

View in Genome Browser
Species Human (GRCh38)
Location 11:45391280-45391302
Sequence CCTCGGAGCTGGGGAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081734046_1081734057 -8 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734057 11:45391280-45391302 CCTCGGAGCTGGGGAGTGGGGGG No data
1081734044_1081734057 -3 Left 1081734044 11:45391260-45391282 CCTCTCCTGCCCAGTGATGGCCT No data
Right 1081734057 11:45391280-45391302 CCTCGGAGCTGGGGAGTGGGGGG No data
1081734041_1081734057 19 Left 1081734041 11:45391238-45391260 CCTGTGCTAAAGACTGCCTGAGC No data
Right 1081734057 11:45391280-45391302 CCTCGGAGCTGGGGAGTGGGGGG No data
1081734042_1081734057 3 Left 1081734042 11:45391254-45391276 CCTGAGCCTCTCCTGCCCAGTGA No data
Right 1081734057 11:45391280-45391302 CCTCGGAGCTGGGGAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081734057 Original CRISPR CCTCGGAGCTGGGGAGTGGG GGG Intergenic
No off target data available for this crispr