ID: 1081734066

View in Genome Browser
Species Human (GRCh38)
Location 11:45391308-45391330
Sequence AGGGCGGTTGGAGGAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081734046_1081734066 20 Left 1081734046 11:45391265-45391287 CCTGCCCAGTGATGGCCTCGGAG No data
Right 1081734066 11:45391308-45391330 AGGGCGGTTGGAGGAGGAGAGGG No data
1081734056_1081734066 5 Left 1081734056 11:45391280-45391302 CCTCGGAGCTGGGGAGTGGGGGG No data
Right 1081734066 11:45391308-45391330 AGGGCGGTTGGAGGAGGAGAGGG No data
1081734049_1081734066 15 Left 1081734049 11:45391270-45391292 CCAGTGATGGCCTCGGAGCTGGG No data
Right 1081734066 11:45391308-45391330 AGGGCGGTTGGAGGAGGAGAGGG No data
1081734044_1081734066 25 Left 1081734044 11:45391260-45391282 CCTCTCCTGCCCAGTGATGGCCT No data
Right 1081734066 11:45391308-45391330 AGGGCGGTTGGAGGAGGAGAGGG No data
1081734047_1081734066 16 Left 1081734047 11:45391269-45391291 CCCAGTGATGGCCTCGGAGCTGG No data
Right 1081734066 11:45391308-45391330 AGGGCGGTTGGAGGAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081734066 Original CRISPR AGGGCGGTTGGAGGAGGAGA GGG Intergenic
No off target data available for this crispr