ID: 1081736564

View in Genome Browser
Species Human (GRCh38)
Location 11:45408571-45408593
Sequence GACTCACTGATCATGCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081736557_1081736564 1 Left 1081736557 11:45408547-45408569 CCCAGCCCCAGAGTGGCCTGGCC No data
Right 1081736564 11:45408571-45408593 GACTCACTGATCATGCAGACAGG No data
1081736558_1081736564 0 Left 1081736558 11:45408548-45408570 CCAGCCCCAGAGTGGCCTGGCCT No data
Right 1081736564 11:45408571-45408593 GACTCACTGATCATGCAGACAGG No data
1081736560_1081736564 -5 Left 1081736560 11:45408553-45408575 CCCAGAGTGGCCTGGCCTGACTC No data
Right 1081736564 11:45408571-45408593 GACTCACTGATCATGCAGACAGG No data
1081736552_1081736564 26 Left 1081736552 11:45408522-45408544 CCACTGTGGAGGGTCAGCCTGGC No data
Right 1081736564 11:45408571-45408593 GACTCACTGATCATGCAGACAGG No data
1081736556_1081736564 2 Left 1081736556 11:45408546-45408568 CCCCAGCCCCAGAGTGGCCTGGC No data
Right 1081736564 11:45408571-45408593 GACTCACTGATCATGCAGACAGG No data
1081736561_1081736564 -6 Left 1081736561 11:45408554-45408576 CCAGAGTGGCCTGGCCTGACTCA No data
Right 1081736564 11:45408571-45408593 GACTCACTGATCATGCAGACAGG No data
1081736553_1081736564 9 Left 1081736553 11:45408539-45408561 CCTGGCTCCCCAGCCCCAGAGTG No data
Right 1081736564 11:45408571-45408593 GACTCACTGATCATGCAGACAGG No data
1081736559_1081736564 -4 Left 1081736559 11:45408552-45408574 CCCCAGAGTGGCCTGGCCTGACT No data
Right 1081736564 11:45408571-45408593 GACTCACTGATCATGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081736564 Original CRISPR GACTCACTGATCATGCAGAC AGG Intergenic
No off target data available for this crispr