ID: 1081738225

View in Genome Browser
Species Human (GRCh38)
Location 11:45420079-45420101
Sequence CTGGAATGGTGCCATGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081738225_1081738231 19 Left 1081738225 11:45420079-45420101 CCAGAATCATGGCACCATTCCAG No data
Right 1081738231 11:45420121-45420143 TTTTGTATGCACCCTGGAAATGG No data
1081738225_1081738232 20 Left 1081738225 11:45420079-45420101 CCAGAATCATGGCACCATTCCAG No data
Right 1081738232 11:45420122-45420144 TTTGTATGCACCCTGGAAATGGG No data
1081738225_1081738230 13 Left 1081738225 11:45420079-45420101 CCAGAATCATGGCACCATTCCAG No data
Right 1081738230 11:45420115-45420137 GCAGCATTTTGTATGCACCCTGG No data
1081738225_1081738233 25 Left 1081738225 11:45420079-45420101 CCAGAATCATGGCACCATTCCAG No data
Right 1081738233 11:45420127-45420149 ATGCACCCTGGAAATGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081738225 Original CRISPR CTGGAATGGTGCCATGATTC TGG (reversed) Intergenic
No off target data available for this crispr