ID: 1081741348

View in Genome Browser
Species Human (GRCh38)
Location 11:45443210-45443232
Sequence CTGGATTCTCTGGGACCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081741348_1081741356 14 Left 1081741348 11:45443210-45443232 CCCCAGGGTCCCAGAGAATCCAG No data
Right 1081741356 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data
1081741348_1081741357 15 Left 1081741348 11:45443210-45443232 CCCCAGGGTCCCAGAGAATCCAG No data
Right 1081741357 11:45443248-45443270 CTCCATGCACTGATGGCTCTGGG No data
1081741348_1081741354 8 Left 1081741348 11:45443210-45443232 CCCCAGGGTCCCAGAGAATCCAG No data
Right 1081741354 11:45443241-45443263 TTAGCACCTCCATGCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081741348 Original CRISPR CTGGATTCTCTGGGACCCTG GGG (reversed) Intergenic
No off target data available for this crispr