ID: 1081741353

View in Genome Browser
Species Human (GRCh38)
Location 11:45443229-45443251
Sequence GGAGGTGCTAAGTATCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081741353_1081741356 -5 Left 1081741353 11:45443229-45443251 CCAGAAAGATACTTAGCACCTCC No data
Right 1081741356 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data
1081741353_1081741359 21 Left 1081741353 11:45443229-45443251 CCAGAAAGATACTTAGCACCTCC No data
Right 1081741359 11:45443273-45443295 TCCCAGCAGAGCCATTACACTGG No data
1081741353_1081741357 -4 Left 1081741353 11:45443229-45443251 CCAGAAAGATACTTAGCACCTCC No data
Right 1081741357 11:45443248-45443270 CTCCATGCACTGATGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081741353 Original CRISPR GGAGGTGCTAAGTATCTTTC TGG (reversed) Intergenic
No off target data available for this crispr