ID: 1081741356

View in Genome Browser
Species Human (GRCh38)
Location 11:45443247-45443269
Sequence CCTCCATGCACTGATGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081741352_1081741356 4 Left 1081741352 11:45443220-45443242 CCAGAGAATCCAGAAAGATACTT No data
Right 1081741356 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data
1081741345_1081741356 23 Left 1081741345 11:45443201-45443223 CCACCTTACCCCCAGGGTCCCAG No data
Right 1081741356 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data
1081741344_1081741356 24 Left 1081741344 11:45443200-45443222 CCCACCTTACCCCCAGGGTCCCA No data
Right 1081741356 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data
1081741349_1081741356 13 Left 1081741349 11:45443211-45443233 CCCAGGGTCCCAGAGAATCCAGA No data
Right 1081741356 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data
1081741348_1081741356 14 Left 1081741348 11:45443210-45443232 CCCCAGGGTCCCAGAGAATCCAG No data
Right 1081741356 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data
1081741347_1081741356 15 Left 1081741347 11:45443209-45443231 CCCCCAGGGTCCCAGAGAATCCA No data
Right 1081741356 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data
1081741351_1081741356 5 Left 1081741351 11:45443219-45443241 CCCAGAGAATCCAGAAAGATACT No data
Right 1081741356 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data
1081741353_1081741356 -5 Left 1081741353 11:45443229-45443251 CCAGAAAGATACTTAGCACCTCC No data
Right 1081741356 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data
1081741350_1081741356 12 Left 1081741350 11:45443212-45443234 CCAGGGTCCCAGAGAATCCAGAA No data
Right 1081741356 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data
1081741346_1081741356 20 Left 1081741346 11:45443204-45443226 CCTTACCCCCAGGGTCCCAGAGA No data
Right 1081741356 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081741356 Original CRISPR CCTCCATGCACTGATGGCTC TGG Intergenic
No off target data available for this crispr