ID: 1081741359

View in Genome Browser
Species Human (GRCh38)
Location 11:45443273-45443295
Sequence TCCCAGCAGAGCCATTACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081741352_1081741359 30 Left 1081741352 11:45443220-45443242 CCAGAGAATCCAGAAAGATACTT No data
Right 1081741359 11:45443273-45443295 TCCCAGCAGAGCCATTACACTGG No data
1081741355_1081741359 3 Left 1081741355 11:45443247-45443269 CCTCCATGCACTGATGGCTCTGG No data
Right 1081741359 11:45443273-45443295 TCCCAGCAGAGCCATTACACTGG No data
1081741353_1081741359 21 Left 1081741353 11:45443229-45443251 CCAGAAAGATACTTAGCACCTCC No data
Right 1081741359 11:45443273-45443295 TCCCAGCAGAGCCATTACACTGG No data
1081741358_1081741359 0 Left 1081741358 11:45443250-45443272 CCATGCACTGATGGCTCTGGGTG No data
Right 1081741359 11:45443273-45443295 TCCCAGCAGAGCCATTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081741359 Original CRISPR TCCCAGCAGAGCCATTACAC TGG Intergenic
No off target data available for this crispr