ID: 1081741413

View in Genome Browser
Species Human (GRCh38)
Location 11:45443580-45443602
Sequence CTCTCCCAACAGCTGGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081741413_1081741417 -6 Left 1081741413 11:45443580-45443602 CCAAAATCCAGCTGTTGGGAGAG No data
Right 1081741417 11:45443597-45443619 GGAGAGTCGGGTTCTTCCAGAGG No data
1081741413_1081741420 30 Left 1081741413 11:45443580-45443602 CCAAAATCCAGCTGTTGGGAGAG No data
Right 1081741420 11:45443633-45443655 TCTGTTCCATGCCTCTCTCCTGG 0: 11
1: 53
2: 115
3: 186
4: 471
1081741413_1081741418 3 Left 1081741413 11:45443580-45443602 CCAAAATCCAGCTGTTGGGAGAG No data
Right 1081741418 11:45443606-45443628 GGTTCTTCCAGAGGCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081741413 Original CRISPR CTCTCCCAACAGCTGGATTT TGG (reversed) Intergenic
No off target data available for this crispr