ID: 1081743297

View in Genome Browser
Species Human (GRCh38)
Location 11:45455934-45455956
Sequence GATAGTAATTCCTCTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081743297_1081743298 -4 Left 1081743297 11:45455934-45455956 CCTTTGAGAGAGGAATTACTATC No data
Right 1081743298 11:45455953-45455975 TATCCTCATCCTCATTTCATAGG No data
1081743297_1081743302 16 Left 1081743297 11:45455934-45455956 CCTTTGAGAGAGGAATTACTATC No data
Right 1081743302 11:45455973-45455995 AGGTGAGGAAACTGAAGTCTAGG No data
1081743297_1081743300 1 Left 1081743297 11:45455934-45455956 CCTTTGAGAGAGGAATTACTATC No data
Right 1081743300 11:45455958-45455980 TCATCCTCATTTCATAGGTGAGG No data
1081743297_1081743304 20 Left 1081743297 11:45455934-45455956 CCTTTGAGAGAGGAATTACTATC No data
Right 1081743304 11:45455977-45455999 GAGGAAACTGAAGTCTAGGGAGG No data
1081743297_1081743303 17 Left 1081743297 11:45455934-45455956 CCTTTGAGAGAGGAATTACTATC No data
Right 1081743303 11:45455974-45455996 GGTGAGGAAACTGAAGTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081743297 Original CRISPR GATAGTAATTCCTCTCTCAA AGG (reversed) Intergenic
No off target data available for this crispr