ID: 1081746010

View in Genome Browser
Species Human (GRCh38)
Location 11:45473095-45473117
Sequence CCACAGAGGGAGACCGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081746010_1081746024 19 Left 1081746010 11:45473095-45473117 CCACCAACGGTCTCCCTCTGTGG No data
Right 1081746024 11:45473137-45473159 AACAGGAAGGCATGGCCAGTGGG No data
1081746010_1081746015 -5 Left 1081746010 11:45473095-45473117 CCACCAACGGTCTCCCTCTGTGG No data
Right 1081746015 11:45473113-45473135 TGTGGCCCAGCCTAACACTCTGG No data
1081746010_1081746023 18 Left 1081746010 11:45473095-45473117 CCACCAACGGTCTCCCTCTGTGG No data
Right 1081746023 11:45473136-45473158 GAACAGGAAGGCATGGCCAGTGG No data
1081746010_1081746016 -4 Left 1081746010 11:45473095-45473117 CCACCAACGGTCTCCCTCTGTGG No data
Right 1081746016 11:45473114-45473136 GTGGCCCAGCCTAACACTCTGGG No data
1081746010_1081746021 6 Left 1081746010 11:45473095-45473117 CCACCAACGGTCTCCCTCTGTGG No data
Right 1081746021 11:45473124-45473146 CTAACACTCTGGGAACAGGAAGG No data
1081746010_1081746025 20 Left 1081746010 11:45473095-45473117 CCACCAACGGTCTCCCTCTGTGG No data
Right 1081746025 11:45473138-45473160 ACAGGAAGGCATGGCCAGTGGGG No data
1081746010_1081746022 11 Left 1081746010 11:45473095-45473117 CCACCAACGGTCTCCCTCTGTGG No data
Right 1081746022 11:45473129-45473151 ACTCTGGGAACAGGAAGGCATGG No data
1081746010_1081746019 2 Left 1081746010 11:45473095-45473117 CCACCAACGGTCTCCCTCTGTGG No data
Right 1081746019 11:45473120-45473142 CAGCCTAACACTCTGGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081746010 Original CRISPR CCACAGAGGGAGACCGTTGG TGG (reversed) Intergenic
No off target data available for this crispr