ID: 1081751556

View in Genome Browser
Species Human (GRCh38)
Location 11:45514725-45514747
Sequence TTTGACACACATAGCCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081751553_1081751556 -1 Left 1081751553 11:45514703-45514725 CCAGGAGTAGGGATTCCCTGACT No data
Right 1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG No data
1081751552_1081751556 0 Left 1081751552 11:45514702-45514724 CCCAGGAGTAGGGATTCCCTGAC No data
Right 1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG No data
1081751550_1081751556 10 Left 1081751550 11:45514692-45514714 CCTCTCGGCTCCCAGGAGTAGGG No data
Right 1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081751556 Original CRISPR TTTGACACACATAGCCACCT TGG Intergenic
No off target data available for this crispr